1. In a tabular form, summarize your observations of the responses of Paramecium to various stimuli and precisely discuss what physiological mechanisms mediate the responses. Stimulus Electric current Gravity Light Contact Chemicals (1% acetic acid) Response to stimulus Physiological mechanism
Q: 70203 52000 CHIRAGRA SPIDER CONCH Harpago chiragra Linnaeus 1758 49+0
A: Introduction Characteristics of Mollusca are- 1. They are triploblastic. 2. They are bilaterally…
Q: 4. What is genetic drift? Genetic drift is a mechanism beside natural selection that can bring about…
A: Evolution is defined as the change in frequency of alleles in a population over time.
Q: Information about Aurelia Strobila. give all the details about this
A: Aurelia is commonly known as moon jellies.It belongs to the class Scyphozoa and phylum Cnidaria.
Q: A Method of Consolidating and Combining EST and mRNA Alignments to a Genome to Enumerate Supported…
A: The total collection of DNA sequences present in a cell makes up the genome. The human genome is…
Q: Explain Darwin's Theory of Natural Selection using these terms: exponential rate of increase,…
A: Charles Darwin, the author of 'Origin of Species was a born naturalist. He is known for the most…
Q: In cucumbers, speckled fruit color (u') is dominant to uniform fruit color (u), and large spines…
A: Given Speckled fruit colour U+ is dominant to uniform fruit colour u Large spines SS+ is dominant…
Q: In a combination of excitatory or inhibitory synaptic connections the following is true it is poorly…
A: The Stretch reflex is an example of a monosynaptic reflex with direct connections between the…
Q: give their taxonomic classification and describe their unique characteristics
A: Spiny lobsters live on reefs and in the mangrove swamps. Their diet is composed of mollusks, plants,…
Q: 12. Vitamin C: coenzyme form, functional groups, mechanism of action, biological role, sources,…
A: Vitamins are organic compounds that are required for various biological functions such as growth,…
Q: Compare and contrast the acquisition and transport of water and nutrients in plants with the…
A: Introduction Nutrition is a process through which an organism acquire food necessary to generate…
Q: Which of these options is NOT an example of a hypothesis that supports the occurrence of ecological…
A: The manner in which the way of means of in which new species turn out to be an end result of…
Q: Arrange and match in chronological order the pathway of water in syconoid sponges: Dermal ostium…
A: Sponges Sponges belong to the kingdom porifera also knows as pore bearing animals.
Q: In own words, give 5 or more reasons why most of the clinical features of the diseases…
A: Mitochondria are an essential component of eukaryotic cells, and their failure has been linked to a…
Q: A certain plant species has dominant red flower color (R) to the recessive white flower color (r). A…
A: Introduction Inheritance is the process of transmitting traits from parent to offspring. The traits…
Q: Unlike natural selection, is not related to an individual’s ability to survive and may result in…
A: Natural selection is the variation in individual survival and procreation brought on by phenotypic…
Q: You are in a hurry to test a bacterial culture for spore production. You grow the culture or 12…
A: Endospore staining is a procedure used to observe bacterial endospores and differentiate them from…
Q: 1. Briefly compare and contrast catabolism/anabolism and how these relate to metabolism. Give an…
A: Introduction The group of chemical processes in organisms that maintain life is known as…
Q: Below is the CODING sequence of a gene. An A is inserted at position 131. Insert the variant and…
A: Introduction Central Dogma: it is the key mechanism by which DNA can be transcribed into mRNA by…
Q: in which way do cells use glucose during the production of ATP
A: The ability to accomplish work is defined as energy. While there are many different types of energy,…
Q: Which among the parameters measured influences one another or are dependent with one another?
A: Variables In research, "variables are the things you want to study , control , measure and…
Q: Which of the following is true about nucleosides and nucleotides? Choose all that apply. A…
A: Nucleoside consists of a nitrogenous base covalently attached to a sugar. Nucleotide consists of…
Q: para athway membrane capacitance Ach receptor channel conductance end plate current membrane…
A: The end plate is a bilayer of the cartilage and bone that separates the intervertebral discs from…
Q: What is the function of NEU?
A: An oncogene is a mutated gene with the ability to cause cancer.
Q: In which portions of the upright test tube do Paramecium tend to aggregate. Explain. What is…
A: Single-celled protists known as paramecium or paramecia can be found in watery areas in the wild.…
Q: Why do water-dwelling animals have thicker bones than land-dwelling animals?
A: Bones are the organs of support and form the part of skeletal system. These maintain the body shape…
Q: Differentiate the virus from a cell
A: Introduction The cell is the basic unit of life as it performs all the basic physiological and…
Q: Describe how coevolution, as with the hummingbird bill and hummingbird-pollinated flowers, is…
A: Coevolution is a multifaceted, intricate process. It can manifest in interactions among closely…
Q: Question 1 GO describes a phase where cells are "resting", and are essentially outside of the cell…
A: Genes are distinct units of hereditary traits made up of a particular nucleotide sequence in DNA or…
Q: During translation, the ribosome follows along the mRNA template in the reaches a at which point a…
A: Translation The process of translating mRNA into chain of polypetide.
Q: Describe the two kinds of reproductive isolating mechanisms and explain their role in speciation.
A: The process of speciation is how populations develop into separate species. When populations are…
Q: Please answer fast which modern tecniques used in following countries for the production of…
A: Modern agricultural techniques are farming techniques that include a lot of labor, huge financial…
Q: Northern blots are valuable tools to analyze the mRNA level present in a sample. Describe an…
A: The goal of a northern blot is to monitor the expression of a particular genome in tissues, organs,…
Q: If a person is severely dehydrated, explain what would happen to the plasma volume, hematocrit, and…
A: Water is very much important for living organisms including human beings. Different chemical…
Q: Consider the DNA CAAGGAGCAAGTAGCCAAGA and briefly describe the plasmid to be used and the method for…
A: Explanation: A plasmid is a circular piece of DNA that will be utilized in the process of inserting…
Q: == What was the order of the pigments on the chromatography paper from the bottom up? Postlab 6.13…
A: The chromatographic technique is based on the interaction of solute and solvent molecules. By the…
Q: why is fluid mosaoc model called "fluid mosaic model" ?
A: Introduction :- Different facts on the composition of functional cell membranes are explained by the…
Q: The endplate potential decreases with distance because
A: The end plate potential is a potential that propagates to the neighbouring patch of muscle fibre…
Q: Discuss the importance of determining the physical characteristics/properties of citrus and onion
A: introduction: 1)Citrus; Swingle (1943) devided the genus citrus into three independent genra:…
Q: Vicariance describes a fundamental process preventing gene flow which is part of Select one: a.…
A: Introduction Speciation is a process by which new plant or animal species is formed. Speciation is…
Q: Cat DNA is much more similar to dog DNA than to tortoise DNA. Why? (a) Cats and dogs are both…
A: All living things have the same genetic material (DNA), comparable genetic codes, and the same…
Q: Caspases are involved in ___. Select one: a. protein dephosphorylation b. programmed cell death c.…
A: Ans- B) programmed cell death Programmed cell death is known as Apoptosis, which regulates the…
Q: 2. Your supervisor instructs you to prepare chemically competent cells for heat shock transformation…
A: Every day, genetic engineering's advancement, comprehension, and development dive deeper, and with…
Q: sIMILARITIES AND DIFFERENCES ecologist vs. environmentalist
A: Differences between ecologist and environmentalist: I) Ecologists are those who study ecology i.e.…
Q: List the phylum for the species, and assign the following structures to the correct phylum and…
A: We are allowed to do upto three sub part of a question. Please repost the undone questions again.…
Q: , 12) In Figure 1 to the right, a semi-permeable membrane separates sugar solution from pure water.…
A: Introduction A semipermeable membrane is one that permits some molecules or ions to pass through it…
Q: Changes to the nucleotide sequence in the primary transcript (pre-mRNA) may lead to an error in…
A: * Transcription is the process in which mRNA will be made from DNA . *The end product of…
Q: Sickle cell anemia is a human genetic disorder caused by an autosomal recessive allele. A couple…
A: Introduction One of the genetic diseases known as sickle cell disease is sickle cell anaemia. Red…
Q: Why is it essential that the primary stain and the counterstain be contrasting colors in…
A: The gram staining is used to distinguish between gram negative and gram positive bacteria. It was…
Q: compare eukaryotic and prokaryotic cells
A: Prokaryotic And Eukaryotic Cells Prokaryotic cells, which comprise bacteria and blue green algae,…
Q: In an anaerobic environment, facultative anaerobes use what kind of pathway to produce ATP?…
A: Adenosine Triphosphate (ATP) is used by organisms to drive cellular processes and synthesis of…
Step by step
Solved in 3 steps
- view View Help O Editing v AaBbCc AaBbCc AaBbCc No Spacing AaBbCc Normal Heading 1 Heading 2 Paragraph Styles 35) T/F Buffers cause abrupt and large changes in the pH of the body by releasing or binding H+ ions. 36) T/F During depolarization, the inside of the neuron's membrane becomes less negative. tions: On You2.) what of these nerve fiber has action potenital moving toward the central nervous system ? sensory fiber sympathetic nerve fiber parasympatheic nerver fiber motor fiber question 3 : The autonimic nervous system controls involuntary muscle such as the cardiac & smooth muscle true False question 5 It is important to remeber to the neurogila cells are not direclty part of ; A.) forming insulating membrane to cover the axon b. ) anchoring neuron to capilliares or nutrient supply c. ) controlling the neuron enviornment d. ) begin a pathways for the action potentialChoose the type of information that the soft organ smooth muscle first order neuron are sending to the central nervous system: 1, sterogotic information 2, stretch information 3, proprioceptive information 4, temperature information This is the second time in 10 min I asked this question, the fomer one been rejected due to incompleted. But this is the whole inforamtion I had copied from my home work, no letter missed.
- You are a PhD student interested in studying the effects of hypoxia on the behavior of mesenchymal stemcells. You want to culture cells in a hypoxic environment. You decide to use a tri-gas incubator, which allowsfor precise control of the oxygen tension, as well as the partial pressures of nitrogen and carbon dioxide inthe cell culture system.A tri-gas incubator is a type of cell culture system that allows for the control of the three main gasesin the culture environment: oxygen, carbon dioxide, and nitrogen. The oxygen tension and carbon diox-ide tension in the culture environment can be controlled by adjusting the percentages of these gases in thegas mixture that is supplied to the incubator. Hint: To calculate the partial pressure of nitrogen, you can use pN2= pTotal −pO2−pCO2 Part 1.3Calculate the partial pressure of nitrogen (in mmHg) that would be required. Part 1.4In planning for this experiment, you have to order gas cylinders ahead of time. Which cylinder should youorder the…Match the following terms with their functions External environmental cues about time of day v Choose. Microsleeps Polyphasic Sleep Zaitgebers Sleeps once per day Monophasic Sleep Zeitgeist Sleeps multiple times per day Choose...The picture below is a cross section of the thallus or blade of Fucus (40x). How would you describe its tissue organization? Explain your reasoning. Make a sketch of this organism and using your Photo Atlas or online resources, label cortex cells, medulla cells. Upload your sketch here.
- Discuss the Nervous System of the Meerkats, its transmission of signals, transmission of information in neurons.Discuss and explain the hormonal control and biochemistry of sclerotization of an insect's cuticle.Conotoxin is produced by marine cone snails. Among its effects is to block voltage-gated Ca2+ channels in n eurons. A. What anatomical part of a neuron would be affected by conotoxin? B. How would the neuron's action potential be affected by conotoxin? Explain, using at least TWO of the following terms: threshold, depolarization, repolarization, hyperpolarization, summation, IPSP, EPSP, exocytosis C. If conotoxin affected a somatic motor neuron, would this toxin cause muscle weakness or increased muscle tension? Explain why.
- Please note these are all one question group and should be answered as such! Which of the following statements accurately defines epineurium? A. Fluid-filled space at a synapse through which neurotransmitters diffuse B. A vesicle containing neurotransmitters in the axon terminal of a neuron C. The CT sheath that binds together the groups of fascicles, blood vessels, and lymphatic vessels in a peripheral nerve D. The branch of the ANS that adapts the body for rest and digestion Which of the following statements accurately defines sacral plexus? A. The ventral rami of C1–C4 (and a small contribution from C5) that serve the head and neck B. The ventral rami of L1–L4 that serve the pelvis and lower limb C. The ventral rami of C5–T1 that serve the upper limb D. The ventral rami of L4–S4 that serve the pelvis and lower limb3. Explain all the electrical and mechanical events which occur during each measured wave, segment andinterval. An electrical event would be membrane polarization: depolarization, repolarization, restingmembrane potential, hyperpolarization etc; mechanical events include blood flow, open or closed valves,heart sounds, contraction, relaxation, pressure changes, etc. An example of a complete answer for the P waveis given below. Feel free to use your lecture and/or textbook as a reference to make the connections betweenECG and the cardiac cycle. This is a great way to review for the exam and apply what you are learning. P Wave – During the P wave, depolarization is sweeping from the SA node throughout both atria (electricalevent). This leads to the beginning of atrial contraction (mechanical event).PR Interval -P-R Segment –QRS Complex –Q-T Interval –S-T Segment –T Wave –T-P Segment –R-R Interval –Visit this site (http://openstaxcollege.org/l/neurolab) to see a virtual neurophysiology lab, and to observe electrophysiological processes in the nervous system, where scientists directly measure the electrical signals produced by neurons. Often, the action potentials occur so rapidly that watching a screen to see them occur is not helpful. A speaker is powered by the signals recorded from a neuron and it pops each time the neuron fires an action potential. These action potentials are firing so fast that it sounds like static on the radio. Electrophysiologists can recognize the patterns within that static to understand what is happening. Why is the leech model used for measuring the electrical activity of neurons instead of using humans?