Q: Why are the cell membrane, cytoplasm, and nucleus considered the major parts of the cell?
A: The cell is consists of a cell membrane, organelles and nucleus. The cell membrane holds the…
Q: How Do Proteins Find Their Proper Place inthe Cell?
A: As a newly synthesized protein is formed, it emerges from the ribosome with an N-terminal sequence…
Q: 5. Answer the following questions concerning protein synthesis a. Describe with drawings how…
A: Protein synthesis is known as translation process that perform synthesis of amino acid chain or…
Q: 1. What is the importance of having a molecular section in a hospital laboratory?
A: Introduction Molecular biology:- It is the branch of biology that studies the molecular basis of…
Q: Prepare a flow chart showing the stages of protein synthesis
A: Protein biosynthesis is a core biological process occurring inside cells, balancing the loss of…
Q: 6 What is the complement of the mRNA triplet code in the tRNA? 7 In what way is tRNA different from…
A: RNA molecules are also called ribonucleic acids. RNA is composed of nucleotides attached with each…
Q: explain the roles of rRNA, mRNA, and tRNA and of ribosomes in protein synthesis
A: The process of protein synthesis is accomplished through translation. Translation is a process of…
Q: Describe the different steps in protein synthesis
A: Biomolecules includes carbohydrates, lipids, nucleic acids and proteins. Nucleic acid plays an…
Q: 1: What material(s) is/are transported by the cells within the red oval?
A: Vascular plants are the most dominant type of land/terrestrial plants as they transport both water…
Q: a) Identify three types of RNA and provide a description of each and the role they play in protein…
A: a. Mejor type or RNA is 1. Messanger RNA (mRNA) 2. Ribosomal RNA (rRNA) 3. Transfer RNA (tRNA)…
Q: What are the 3 steps of Protein Synthesis in order O Translation, Transcription, Protein Folding…
A: Protein synthesis is the process in which cells make proteins. It occurs in two stages:…
Q: 1. What are the amino acids translated from the resulting mRNA?
A: The process of transcription occurs only in one strand of the double-stranded DNA. This strand is…
Q: Describe Regulation of Protein Synthesis?
A: Protein synthesis starts with the transcription process where DNA is converted to RNA, which is then…
Q: 1. МСQ 1 form the two layers of the cell membrane. A. Carbohydrates B. Proteins C. Phospholipids D.…
A: The cell membrane is also known as the plasma membrane. It is present in all the cells. The…
Q: describe how ribosomes, mRNA, and tRNA cooperate to produce a protein?
A: Ans: The proteins are synthesized from mRNA using the process called translation, which involves…
Q: Additional ___________Proteins Regulate Transcription and Replication
A: The molecular process such as replication is the formation of DNA from DNA strands so as to pass the…
Q: The process of protein breakdown, recovery, and synthesis is called: a. protein recovery. b. the…
A: Biomolecules are the substances which are used to perform vital functioning in the body. These…
Q: What are the products of transcription and translation?
A: The information encoded within the DNA is encoded through two steps; transcription and translation.…
Q: List the steps of protein synthesis.
A: The translation is the process of synthesis of protein from mRNA. It mainly occurs in ribosomes…
Q: 23. Which of the following is the functional unit of a body? A.mitochondria. b. cytoplasm. c.the…
A: Introduction: A cell is the smallest unit of life which has a definite structure and a specific…
Q: How does protein synthesis start?
A: Protein synthesis is the process of translation of a sequence of amino acids into a protein where…
Q: 7 .Alzheimer disease results from a defect in function of; A „Ribosome B.Mitochondria C.Golgi…
A:
Q: 1. Research on how are hydrogen bonds involved in the transfer of genetic information? CITE YOUR…
A: DNA and RNA are nucleic acids, which are large linear polymers that hold data in a format that can…
Q: 1. What is a cytoskeleton? What are its main constituents in animal cells?
A: The question is asking about cytoskeleton which are the part of a cell which holds the rigidity of…
Q: 2. The sequence of bases in a segment of mRNA is UUUCAUAAG. Answer the following questions: a. What…
A: mRNA is the transcript that is produced during the process of transcription from DNA by the enzyme…
Q: 6. Which are responsible for the template in the synthesis of proteins which in turn control the…
A: The protein synthesis takes place in the cytoplasm of the cell. The protein synthesis activity and…
Q: How ribosome is made inside the cell?
A: Cells: [plant/animal] Cells are the basic unit of life as they compiled in discrete…
Q: What are the different types of RNA and their contributions to the process of Protein Synthesis?
A: a. messenger RNA (mRNA) b. ribosomal RNA (rRNA) c. transfer RNA (tRNA)
Q: 1. Identify the name of the correct amino acid that corresponds to the correct tRNA codon and mRNA…
A: The process of the formation of the mRNA from the DNA is called as transcription. The process of the…
Q: 1. What is the production of RNA called and what is the enzyme that catalyzes the process?
A: Apologies. We only answer one question at a time. We will answer the first one as the exact one…
Q: Describe the importance of protein synthesis and the genetic code
A: To produce protein molecules, a cell must first transfer information from DNA to mRNA via the…
Q: How many codons are there in the mRNA?
A: Here, the given original DNA sequence is: 5'ATGCCTGGACGCAATGCGAGCTGGCTTAACTCAGGGCGTTGA3' So,the mRNA…
Q: Would it be possible to calculate the cost of protein synthesis, including the cost of making mRNA…
A: The process of protein synthesis is crucial in a living cell as it is one of the important…
Q: How might protein synthesis execute differently if a mutation occurs?
A: point mutations occur on a single nucleotide in the DNA, these can result in codon differences in…
Q: 1. Decoding mRNA into amino acids is called translation.
A: above given statements are about transcription, translation process and how amino acids makes a…
Q: 20. Which of the following correctly identifies the progression from individual molecules to a…
A: The human body is made up of organic and inorganic components, where 60% of the human body is made…
Q: 1. Explain the importance of gluconeogenesis. Where does it occur in the cell? Which type of tissue…
A: Gluconeogenesis is the synthesis of glucose from those compounds that are not carbohydrates.…
Q: Discuss the difference between intron and Exon
A: Exons are named as nucleic acid coding successions & they are available in mRNA. Introns are…
Q: 2. How ribosome is made inside the cell?
A: Cells are the basic functional building blocks of all the living beings. The cells play a major role…
Q: Although terminally differentiated cells do not divide, the nuclei in these cells are still the site…
A: Cell is the basic structural, functional, and biological unit of all known organisms. The cell…
Q: 6. [1] Given the DNA strand, GGACTGATT which of the following is its complementary mRNA? a CCTGACTAA…
A: Transcription Transcription is a process in which the DNA(deoxyribonucleic acid) is transcribed into…
Q: Define protein synthesis
A: Proteins are polymers of amino acids. The amino acid sequence is determined by the nitrogenous base…
Q: Describe the relative roles of DNA and RNA in protein synthesis?
A: DNA molecules are the storage for the genetic information but they cannot do anything by itself. RNA…
Q: How is a protein made inside the cell, from the very start until when it is shaped and packaged?
A: Proteins are an important biomolecule made up of long chains of amino acids. They are important for…
Q: 1. The enzyme activity that forms peptide bonds on the ribosome is called peptidyl transferase.…
A: Answer:- The process in which the peptide bonds formation occur in between the ribosome called…
noIntroduction:-
- Protein synthesis is process in which polypeptide chains are formed from coded combinations of single aminoacids inside the cell.
- The synthesis of new polypeptides requires a coded sequence.
- Protein synthesis takes place within the nucleus and ribosomes of a cell and is regulated by DNA and RNA.
Step by step
Solved in 3 steps
- 1) Translate a mRNA sequence into a protein sequence using the genetic code. 2) write the complementary base pairs for a single strand of DNA.1. Where is protein produced in a cell? 2. What scientists discovered the structure of DNA? 3. What is the structure of DNA? 4. What makes up a nucleotide? 5. What are the 4 Nitrogenous bases found in DNA? 6. What type of bond is between the base pairs in DNA? 7. After replication, how many strands are old and how many are new? 8. What enzyme unzips or separates the original DNA strands?1. Using the DNA provided transcribe DNA into MRNA. 2. Use the mRNA strand you created and break it up into codons. 3. Plug the codons into the amino acid chart to determine the correct amino acid needed to build that protein. 4. Identify the protein you made by comparing the sequence to the pictures 5. Answer the questions for each protein molecule you build before moving on to the next. Protein 1: DNA AAGACCGTATAC MRNA Amino Acid Sequence 1. Which kind of protein molecule did this gene make? 2. How does this protein help the body maintain homeostasis?
- 1. What's the role of DNA in protein synthesis? 2. What occurs during transcription and why is it important? 3. List two differences between DNA and RNA?1. What is the function of DNA? 2. What two membranes protect the fragile DNA molecules from damage?3. Briefly describe the function of the following in protein synthesis: a) rRNA, b) tRNA c) mRNA
- 23. Human genetic material is represented in the diagram below. The region labeled A is made up of a section of O glucose that may be copied to make DNA DNA that may direct protein synthesis a protein that becomes an enzyme a carbohydrate made from amino acidsI learned that the base pairs for DNA are and and the base pair of RNA are and I learned that together with the replication are the processes of protein synthesis. andBelow are the steps of protein synthesis. What is the correct sequential order? 1. MRNA is formed with codons as product of transcription. 2. Codons are translated and polypeptide chain is transferred. 3. mRNA moves into cytoplasm and becomes associated with ribosomes. 4. DNA in nucleus serves as a template. 5. Anticodon - codon complementary base pairing occurs with tRNA and MRNA. * 4, 1, 3, 2, 5 4, 3, 1, 5, 2 O 4, 1, 2, 3, 5 O 4, 1, 3, 5, 2
- 1. How are nucleotides formed? In details summarize the process of DNA replication. In details summarize the process of Translation and post translation process. In details summarize the process of transcription. Explain how do you sequence the DNA1. What are chromosomes and where are they located? 2. How many chromosome do humans have? How are chromosomes inherited? 3. What are the components of a nucleotide? Name the four types of nucleotides. 4. What type of bonds holds the two DNA strands together? 5. What is complementary base pairing? 6. How does the DNA between individuals differ? 7. Define DNA replication 8. What is the function of the enzyme helicase in DNA replication? (unwinds and unzips DNA) 9. What is the function of the enzyme DNA polymerase in DNA replication? 10. DNA replication is semiconservative. Explain what this means. 11. Which method do scientist utilize to make extra copies (amplification) of DNA? 12. Describe the PCR technique. Why do scientist add primers, DNA polymerase and nucleotides during PCR method? Explain the purpose of each.A......of a DNA consists of a sugar, a phosphate, and a nitrogen containing base. A....... is a change in the base sequence of a DNA molecule Took x-ray images of DNA molecule Name 3 types of RNA and list their roles in making proteins