1. What would be the amino acid sequence encoded by the mRNA 5' C C A U G A C G U C G G A U C A A U G A G C 3' 2. If the nucleotide bolded and underlined in red in part 1 changes from C to a G, what type of mutation would that be? 3. What would happen to the amino acid sequence if the C bolded in red in part 1 is changed to a G? 4. What would happen to the amino acid sequence if the C bolded in red is deleted?
Q: 14. Now imagine that a mutation occurred in the g of the codon below and the G became a C. How would…
A: According to guidelines we have to answer the first question only. so please kindly post the…
Q: the sequence of a DNA template is 17. What is the sequence of the mRNA that will result from the…
A: Transcription is the process by which RNA is synthesized with the help of DNA. Abrupt changes in the…
Q: 5. A DNA sequence of "ACG" will code for the amino acid - (LS1- 1) * Second mRNA base C. UUU Phe UUC…
A: Gene expression refers to the complex, highly-regulated biological process, which involves the…
Q: 7. How many different mRNAs could specify the amino acid sequence met-phe-ser-pro? 8. Agene contains…
A: Ans 7: Genetic codes are triplet in nature. Genetic codons are degenerate in nature, which means,…
Q: 1. Determine what is being meant by each statements: a. It describes mRNA that results in a single…
A:
Q: 1. Given is the 30 nucleotides in the human gene for hemoglobin (the oxygen-carrying protein in the…
A: The transcription is the process in which the mRNA copied information from DNA for protein…
Q: 1. The definition of a gene is: a. the sum of genetic information in an organism b. a segment of…
A: Defination of the gene :-
Q: 8. Which of the following best describes the messenger RNA (MRNA) molecules found in prokaryotes? A.…
A: Disclaimer : Since you have asked multiple question, we will solve the first question for you. If…
Q: The strand of DNA contains the sequence of bases: CGA CCG TAC. What is the sequence of the…
A:
Q: 3. A missense mutation results in the presence of a different amino acid than was encoded by the…
A: Sickle cell anaemia is an autosomal recessive disorder.
Q: DNA Leading strand: 5' AAA ATA | CGC TTT| TTA ATT | AAC CCC GGG 3' A I B |C| D Exons: A, C, D…
A: The process of synthesizing RNA from the genetic information encoded by DNA is called Transcription…
Q: A gene affecting the behavioral outlook of individuals was discovered in several humans who can…
A: Transcription is the process of the formation of RNA from DNA. Through transcription, the…
Q: 2. DNA Sequence: TAC TCC GGC TCT CcC AGT TGA ACT Mutated Sequence: TAC ICI GGC TCT CCA AGT TGA ACT…
A: Let us first convert the 3' to 5' DNA sequence into 5' to 3' mRNA sequence and will then translate…
Q: 5. Now imagine that a mutation occurred in the g of the codon below and the G became a C. How would…
A: point mutation - change in single nucleotide sequence which alter the amino acid .
Q: 6. How many amino acids will the mRNA sequence "AUG GAC CUG UCG UGA" produce? (LS1-1) * Second MRNA…
A: The translation is the process by which the information on the mRNA is transferred into appropriate…
Q: 1. What would be the amino acid sequence encoded by the MRNA 5'CCAUGACGUCGGAUCAAUGAGC 3' 2. If the…
A: DNA replication is the process in whichbbhvgvhghhccvfgcbgvh
Q: )A scientist compares the sequence of a disease gene and a healthy gene and finds that these two…
A: The gene is the unit of heredity that is carried out from the parents to the offspring. This…
Q: The poly A tail of an mRNA molecule was removed by a deadenylase enzyme before it is recognized by…
A: 1) Option D is correct answer for this question because It is this mRNA which decide the sequence of…
Q: 1. Why Phosphate bond is important in DNA or RNA structure? 2. Why G-C forms three hydrogen bonds…
A: Molecular biology is the branch of science that studies various biological molecules like nucleic…
Q: . (a) Which codon is the start codon in the mRNA below? mRNA 5 - AAUAUGCGGAUGCCCGAA -3 AAU…
A: Ans - a.) AUG is the start codon in the mRNA 5 - AAUAUGCGGAUGCCCGAA -3. # AUG acts as initiator…
Q: A gene affecting the behavioral outlook of individuals was discovered in several humans who can…
A: DNA acts as genetic material in most organisms. DNA gets transcribed into mRNA by an RNA polymerase…
Q: 6. Describe transcription, include the following terms: mRNA, RNA polymerase, promoter, template…
A: "Transcription" and "Translation" are two important processes that take place inside the cell for…
Q: 6) The diagram shows a strand of DNA matched to a strand of messenger RNA. MRNA is being made from…
A: Francis crick proposed central dogma which gives the flow of genetic information from DNA to RNA to…
Q: hypothetical protein is 250 amino acids long how many nucleotides are in the code and sequence of…
A: A hypothetical protein is 250 amino acids. Each amino acid residue in a polypeptide chain was coded…
Q: 8.) Answer the following questions regarding the following DNA sequence.…
A: During transcription RNA synthesis occurs over DNA and translation or protein synthesis occurs over…
Q: 11. Now imagine that a mutation occurred in the second T of the codon below and the T became a G.…
A: Introduction: The genetic macromolecule referred to as DNA is highly stable with regards to its base…
Q: A life-form from another universe is found to have nucleic acid which includes six different bases -…
A: Disclaimer: “Since you have asked multiple questions, we will solve the first question for you. If…
Q: 2. An mRNA has a sequence AAAUUACUCGAAAUUGCGUGUAGUS'. DNA, t-RNA and amino acid sequence of the…
A: Introduction DNA is the hereditary material in humans and almost all other organisms. RNA is used to…
Q: 2. Given the mRNA for a protein: 5'-CCGAACGAUGGGCUAUCCCUAACCGUUU --- 3' Write the amino acid…
A: We'll answer the first question since the exact one is not specified. Please submit a new question…
Q: ) Below are some events that occur in the process of translating mRNA into a protein in a bacterial…
A: The translation is the process of creating protein from RNA. Hereditary information is encoded in…
Q: 1. What is the first codon in the mRNA strand? 2. The second codon in the DNA double helix is TAT…
A: The DNA (deoxyribonucleic acid) that forms the genetic material of an individual contains…
Q: 1. Below is a sequence of DNA bases. =T ACTTCACG AGTGAGACT a) Transcribe to MRNA: AUGAAGUGCUCACUCUGA…
A: Transcription is a process in which the DNA sequence is converted to mRNA. In mRMA there is Uracil…
Q: What are the components of the initiation complex for translation
A: Translation is a process in which codon of mRNA code for specific amino acid. These amino acid…
Q: The first base in the tRNA anticodon loop is also wobbling, that is one tRNA is able to pair with…
A: The DNA and RNA are composed of nucleotides. The nucleotides can form hydrogen bonds with each other…
Q: What amino acids are specified by the following base triads on DNA? a. TCA b. CCt c. GGC d. GAT e.…
A: A genetic codon is a triplet nucleotide sequence of RNA molecules that were formed from the…
Q: Mutation #2: • Change the Mutation to RED TACACC IIGGCGACGACT AUGUGG A ACCG CU G CUGA MET -TRP- ASN…
A: Original DNA sequence TAC ACC TTG GCG ACG ACT mRNA sequence AUG UGG AAC CGC UGC UGAAmino…
Q: 5. A DNA sequence of "ACG" will code for the amino acid (LS1- 1) * Second mRNA base U UUU Phe UCU…
A: Each codon in mRNA is made up of three nucleotides, and each codon indicates a certain amino acid…
Q: 1) Assuming that all the appropriate accessory proteins (switches) and RNA polymerase is presence,…
A: Gene expression allows the cell to respond to various environments. Transcripted DNA (mRNA) may have…
Q: 1. (a) "In this mutation, most amino acids are replaced due to a deletion of a nucleotide base."…
A: 1.(a) "In this mutation, most amino acids are replaced due to a deletion of a nucleotide base."…
Q: 6. If the first G changes to A what kind of mutation will happen? Show the change in amino acid…
A: Introduction :- A mutation occurs when the sequence of DNA changes. Mutations can occur as a result…
Q: 1. What is the nucleotide sequence of the mRNA transcribed from the template DNA strand:…
A: Transcription is the process of synthesis of mRNA by using a template DNA strand. Translation is the…
Q: Which of the following initially comes directly in contact with the mRNA during translation? a. 60s…
A: "Since you have asked multiple question, we will solve the first question for you. If you want any…
Q: 2. The sequence of a fragment of one strand of DNA is AATTGCATATACGGGAAATACGACCGG. Transcribe this…
A: DNA (deoxyribonucleic acid) is the hereditary unit of an organism. DNA is a double helical structure…
Q: 5’ AUG UUA CGU AAU GCU GUC GAA UCU AUU UGC UUU ACA UAA 3' Write the sequence of the DNA…
A: The central dogma of life involves three processes. They are: Replication: In this process, copies…
Q: . Considering the following nucleotide sequence in an mRNA molecule: 5’ AUG UUA CGU AAU GCU GUC…
A: The central dogma of life involves three processes. They are: Replication: - In this process,…
Q: 2. A reversion is a mutation that returns a mutant codon back to a codon that gives a wild-type…
A: Reversion mutation is one that causes such a change in the gene that does not cause change in…
Q: 3. Below is the sequence of DNA template for transcribing a segment of mRNA. 5 ATGTGGTTATAGCTAACC 3…
A: In the question, we must write the complementary base of the sequence. Our mRNA sequence will be in…
Q: 1. A portion of the template strand of a DNA molecule that codes for the 5'-end of an mRNA has the…
A:
Q: )Which of the following statements are true? Choose all that apply a)There are multiple codons…
A: The DNA expression involves the protein synthesis which involves a series of events primarily the…
1. What would be the amino acid sequence encoded by the mRNA
5' C C A U G A C G U C G G A U C A A U G A G C 3'
2. If the
3. What would happen to the amino acid sequence if the C bolded in red in part 1 is changed to a G?
4. What would happen to the amino acid sequence if the C bolded in red is deleted?
Trending now
This is a popular solution!
Step by step
Solved in 2 steps
- Which of the following statements is false? a. GTP is an energy source during various stages of translation. b. In the ribosome, peptidyl transferase catalyzes peptide bondformation between amino acids. c. When the mRNA code UAA reaches the ribosome, there isno tRNA to bind to it. d. A long polypeptide is cut off the tRNA in the A site so its Metamino acid links to the amino acid in the P site. e. Forty-two amino acids of a protein are encoded by 126nucleotides of the mRNA.1. Given is the 30 nucleotides in the human gene for hemoglobin (the oxygen-carrying protein in the red blood cells): 3’ TAC-CAC-GTG-GAC-TGA-GGA-CTC-CTC-TTC-AGA 5’ a. What is the amino acid sequence based on this mRNA? b. A very important mutation in human hemoglobin occurs in this DNA sequence, where the T at nucleotide 20 is replace with an A. The mutant hemoglobin is called sickle cell hemoglobin and is associated with severe anemia. What is the amino acid replacement that results in sickle-cell hemoglobin?5' C C A U G A C G U C G G A U C A A U G A G C 3' 2. If the nucleotide bolded and underlined in red in part 1 changes from C to a G, what type of mutation would that be? 3. What would happen to the amino acid sequence if the C bolded in red in part 1 is changed to a G? 4. What would happen to the amino acid sequence if the C bolded in red is deleted?
- 14. Now imagine that a mutation occurred in the g of the codon below and the G became a C. How would this affect the mRNA and the amino acid for that codon? New amino acid Old DNA Old RNA codon Old amino acid New mRNA codon New DNA codon codon АТС АTG 15. This would be an example of which type of a point mutation? 16. Finally, imagine that a mutation occurred in the codon below and an A was inserted between the two Ts. How would this affect the mRNA and the amino acid for that codon? Old DNA codon TTG Old RNA codon Old amino acid New DNA codon TATG New mRNA codon New amino acid 17. This would be an example of which type of a mutation?2. Transcribe the following gene sequence to the appropriate MRNA codons: TCA TTT CCA CAG ACA * AGU AAA GGU GUc UGU 3. Translate the mRNA codons (i.e. your answer to question 2) into the appropriate amino acids using the following Universal Genetic Code Chart. * Universal Genetic Code Chart Messenger RNA Codons and the Amino Acids for Which They Code SECOND BASE A UCU UAU UGU UUU UUC UUA PHE TYR CYS UCC UCA UAC UGC SER UAA UGA STOP LEU STOP UUG UGG} TRP UCG UAG CUU CCU CAU CGU HIS CUC CCC CAC CGC LEU PRO ARG CCA CCG CUA CAA CGA GLN CUG CAG CG AUU AUC ACU AAU AGU AGC AGA ASN SER ILE ACC AAC THR AAA AAGS ACA AUA AUG MET or START LYS ARG ACG AGG S GCU GCC GUU GAU GGU ASP GUC GAC GGC VAL ALA GLY GUA GCA GCG GAA GGA GGG GLU GUG GAG トエーCロ ASE A, L-RST BASE1. DNA: 3’ TACAGTCTGTAGCGTACATTATCGTGACCGACT 5’mRNA:polypeptide chain: 2. a. From the given DNA sequence above, change one base in codon 6 to show nonsense mutation.Rewrite the resulting DNA sequence below and encircle the base that you changed.DNA:mRNA:polypeptide chain:b. Identify the type of base pair substitution that you applied in codon 6 3. a. From the given DNA sequence above, change the third base in codon 4 to show missense mutation. Rewrite the resulting DNA sequence below and encircle the base that you changed.DNA:mRNA:polypeptide chain:b. Identify the type of base pair substitution that you applied in codon 4 4. a. From the given DNA sequence above, change one base in codon 8 to show same sense mutation.Rewrite the resulting DNA sequence below and encircle the base that you changed.DNA:mRNA:polypeptide chain:b. Identify the type of base pair substitution that you applied in codon 8 5. Add an A before codon 3 or delete the middle base in codon 3 to show the shift of reading…
- 1. Given the anticodon in tRNA is CUU, name the amino acid that will be added. 2. Given the anticodon in tRNA is CUU, what is the complementary codon? 3. How many synonyms code for arginine? 4. How many codons code for the amino acid cysteine? 5. How many codons code for the amino acid histidine? 6. How many codons code for the amino acid threonine?1. Given the DNA sequence below: 5’-ACATGTGTACAGGCTTTGTCTGAATGGCTT-3’ 3’-TGTACACATGTCCGAAACAGACTTACCGAA-5’ Translate the mRNA. (Using the 3-letter code for amino acids, write the primary structure of the peptide that will be produced.) 2. Given the DNA sequence below: 5’-ACATGTGTACAGGCTTTGTCTGAATGGCTT-3’ 3’-TGTACACATGTCCGAAACAGACTTACCGAA-5’ Translate the mRNA. (Using the 3-letter code for amino acids, write the primary structure of the peptide that will be produced.)1. The following is the DNA sequence of a gene: 3' TACTAACTTAGCCTCGCATC S' a. What amino acids are coded by this sequence? b. An adenine is inserted in this strand after the first guanine from the left. The resulting polypeptide is six amino acids long. Where is the newly produced nonsense codon located? What is the amino acid sequence in the fragment?
- 11. Determine the genetic codes for the following sequence of 3 amino acids: Asn-Glu-Lys. a. Provide one possible mRNA sequence for this peptide segment. b. Provide the corresponding tRNA anticodon for each amino acid. c. Provide the template DNA sequence for that mRNA. Table 1: Table of codons for amino acids. 1st position (5' end) C 2 G 2nd position (middle) U Phe F Phe F Leu L Leu L Leu L Leu L Leu L Leu L lle 1 lle 1 lle 1 START/Me tM Val V Val V Val V Val V. C Ser S Ser S Ser S Ser S Pro P Pro P Pro P Pro P The T The T The T The T Ala A Ala A Ala A Ala A Tyr Y Tyr Y STOP STOP His Hi His H Gln Q Gin Q Asa N Asa N Lys K Lys K Asp D Asp D Glu E Glu E G Cys C CVS C STOP Trp W Arg R Arg R Arg R Arg R Ser S Ser S Arg R Arg R Gly, G Saly, G Gly G G Gly *START codon signals the initiation of a peptide chain. *STOP codons signal the end of a peptide chain. 3rd position (3' end) JUAG C DURG C SCAG DUAG C1. Given the piece of MRNA: 5'-CCUGCAGUAUGAAACGCCUGGUAGAAGGUGGGAAGUGGUGCGCC-3' 1. Predict the DNA strand sequence from which it was transcribe 2. List the complementary non-coding DNA Sequence 3. List the Amino acid Sequence of the protein coded for. Use the Genetic Code 2. Below is a short segment of a DNA molecule. Translate the DNA codon into MRNA. 5'- TACCATGAGAATTGTGG TCACCTTTTT-3' 3'- ATGGTACTCTTAACACCAGTGGAAAA A-5' MRNA Sequence Amino Acid Sequence5. Fill in the following information for making the following polypeptide (the codon chart is below). Transcribe & Translate the following strand of DNA DNA mRNA Amino acid (abbreviation) 6. Fill in the following information for mutated DNA (the codon chart is below) Transcribe & Translate the following strand of mutated DNA DNA C. MRNA Amino acid (abbreviation) D Focus 188% C0 words EO 梦 0 69°F N 耳 a W 63 ip