Only answer the follow up questions part c) Once a primary RNA transcript is created from a DNA template, it must be modified inseveral ways before becoming messenger RNA (mRNA), ribosomal RNA (rRNA) ortransfer RNA (tRNA). The following image shows RNA processing of one pre-mRNAinto mRNA. Note that pre-RNA is processed in three ways: 1) a 5' methylguanylate cap(G cap) is added, 2) a poly-A tail is added, and 3) the spliceosome removes introns fromthe pre-mRNA transcript. Please redraw the following diagram and label the followingon your diagram:DNAPromoterpre-mRNA(unprocessed)mRNA*5' methylguanylate cap*polyadenylation*Exon (may be more than one)*Intron (may be more than one)TranscriptionRNA processingAAAAAPART C: FOLLOW-UP QUESTIONS1. Why is a poly-A tail important?2. What do introns do? Why do they exist in eukaryotes when they are mostlyabsent in prokaryotes?3. What do you think 'alternative splicing' means, and how might it expand thefunction of a gene?

Name: Only answer the follow up questions part c) Once a primary RNA transcr
Uploaded: 2024-03-20T06:42:55.000Z
Channel: Bartleby
Description: Only answer the follow up questions part c) Once a primary RNA transcript is created from a DNA template, it must be modified inseveral ways before becoming messenger RNA (mRNA), ribosomal RNA (rRNA) ortransfer RNA (tRNA). The following image shows R

Transcription is the second important stage of central dogma involving the formation of an mRNA…

Science

Biology

1. Why is a poly-A tail important? 2. What do introns do? Why do they exist in eukaryotes when they are mostly absent in prokaryotes? 3. What do you think 'alternative splicing' means, and how might it expand the function of a gene?

1. Why is a poly-A tail important? 2. What do introns do? Why do they exist in eukaryotes when they are mostly absent in prokaryotes? 3. What do you think 'alternative splicing' means, and how might it expand the function of a gene?

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter9: Gene Expression And Gene Regulation

Section: Chapter Questions

Problem 16QP: Given the following tRNA anticodon sequence, derive the mRNA and the DNA template strand. Also,...

See similar textbooks

Similar questions

Once a primary RNA transcript is created from a DNA template, it must be modified in several ways before becoming messenger RNA (mRNA), ribosomal RNA (rRNA) or transfer RNA (TRNA). The following image shows RNA processing of one pre-mRNA into mRNA. Note that pre-RNA is processed in three ways: 1) a 5' methylguanylate cap (G cap) is added, 2) a poly-A tail is added, and 3) the spliceosome removes introns from the pre-mRNA transcript. Please redraw the following diagram and label the following on your diagram: DNA Promoter pre-mRNA (unprocessed) mRNA *5' methylguanylate cap *polyadenylation *Exon (may be more than one) *Intron (may be more than one) Transcription RNA processing AAAAA PART C: FOLLOW-UP QUESTIONS 1. Why is a poly-A tail important?: 2. What do introns do? Why do they exist in eukaryotes when they are mostly absent in prokaryotes? 3. What do you think 'alternative splicing' means, and how might it expand the function of a gene?
Once a primary RNA transcript is created from a DNA template, it must be modified in several ways before becoming messenger RNA (mRNA), ribosomal RNA (rRNA) or transfer RNA (tRNA). The following image shows RNA processing of one pre-mRNA into mRNA. Note that pre-RNA is processed in three ways: 1) a 5' methylguanylate cap (G cap) is added, 2) a poly-A tail is added, and 3) the spliceosome removes introns from the pre-mRNA transcript. Please redraw the following diagram and label the following on your diagram: DNA Promoter pre-mRNA (unprocessed) mRNA *5' methylguanylate cap *polyadenylation *Exon (may be more than one) *Intron (may be more than one) Transcription RNA processing AAAAA
c) A gene in a bacteria has the following DNA sequences (the promoter sequence is positioned to the left but is not shown): 5'-CAATCATGGAATGCCATGCTTCATATGAATAGTTGACAT-3' 3'-GTTAGTACCT TACGGTACGAAGTATACTTATCAACTGTA-5' i) By referring to the codon table below, write the corresponding mRNA transcript and polypeptide translated from this DNA strand. 2 Second letter с A UUUPhe UAU Tyr UAC. UGU UGCJ UCU) UCC UCA UUG Leu UCG Cys UUC UUA Ser UAA Stop UGA Stop A UAG Stop UGG Trp G CUU CÚC CCU ССС CAU CGU His САC Pro CC CỦA Leu ССА CAA Arg CGA CUG J CCG) CAG Gin CGG AUU ACU AAU Asn AGU Ser AUC le АСC АCА AAC AAA AGC. Thr JArg AUA AGA AUG Met ACG AAG Lys AGG. GAU Asp GUU) GCU GCC GCA GCG GGU" GGC GGA GGG GUC Val GUA GAC Ala Gly GAA Glu GAGJ GUG ii) If the nucleotide indicated by the highlighted bold letter undergoes a mutation that resulted in deletion of the C:G base pair, what will be the resulting amino acid sequence following transcription and translation? Third letter DUAG DUAG DUAG A. First…
A normal mRNA that reads 5’ – UGCCAUGGUAAUAACACAUGAGGCCUGAAC– 3’ has an insertion mutation that changes the sequence to 5’ -UGCCAUGGUUAAUAACACAUGAGGCCUGAAC– 3’. Translate the original mRNA and the mutated mRNA, and explain how insertion mutations can have dramatic effects on proteins. (Hint: Be sure to find the initiation site.)
) A normal mRNA that reads 5'- UGCCAUGGUAAUAACACAUGAAGGCCUGAAC-3' was an insertion mutation that changes the sequence to 5'- UGCCAUGGUUAAUAACACAUGAGGCGUGAAC-3'. Translate the original mRNA and the mutated mRNA and explain how insertion mutations can have dramatic effects on proteins. ( Hint; Be sure to find the initiation site).
The flu virus maximizes the use of its limited (13.5 kb) genome by using alternative translation initiation sites, overlapping reading frames, and ribosomal frameshifting. For example, part of the viral PA gene includes a rarely used CGU codon. When the ribosome pauses to translate this codon, it may slip ahead by one nucleotide and produce a polypeptide with a diff erent C-terminal sequence. From the partial mRNA sequence shown here, determine the normal polypeptide sequence and the sequence with the frameshift.
One procedure of obtaining cDNA from mRNA is by using oligo(dT) primers. What are oligo(dT)s? Why does using them make sense based on the processing (or modification) of precursor mRNA to get mature mRNA?
Help me please
The mRNA formed from the repeating tetranucleotide UUACincorporates only three amino acids, but the use of UAUC incorporates four amino acids. Why?
The base sequence of the gene coding for a short polypeptide is 5’CTACGCTAGGCGATTGATCATC’3. What would be the base sequence of the mRNA transcribed from this gene? Highlight the start codon sequence State the amino acid sequence of the polypeptide translated from this mRNA Based on the information from part (a) and (b), describe the process used by eukaryotes to produce protein.
What is the sequence of the mRNA transcript that will be produced from the following sequence of DNA? The top strand is the template strand, the bottom strand is the coding strand. 5’ – TCGGGATTAGACGCACGTTGGCATACCTCG – 3’ 3’ – AGCCCTAATCTGCGTGCAACCGTATGGAGC – 5’ Enter the mRNA sequence here (pay close attention to the direction of the molecule!): 5'-_____-3'
Consider the following DNA template: 5’-AAGAGGTTCCAATGCAGGCACTCACCAACTCTTAAATAAA-3’ 3’-TTCTCCAAGGTTACGTCCGTGAGTGGTTGAGAATTTATTT-5’ If the bottom DNA strand is used as template to transcribe mRNA, predict the amino acid sequence that would result from the process of translation. Met-Ala-Leu-Thr-Gln-Glu-Gly Met-Gly-Ser-Leu-Asn-Ser-Gln Met-Thr-Asn-Ser-Leu-Ala-Gln Met-Gln-Ala-Leu-Thr-Asn-Ser Met-Glu-Ala-His-Trp-Ser-Tyr