10. A portion of5'-AUGCCACGAGUUGAC-3'. What amino acid sequence does this codefor? To answer the question please:I) explain what is the genetic code and list the properties of the genetic e2) draw a diagram of protein synthesis;3) determine which tRNA should be attached to the mRNA;4) what is the anticodon for the very first tRNA that will attach to mRNA?mRNA molecule has the sequencean

1. The genetic code is the set of rules followed by cells to read and translate the genetic…

10. A portion of an mRNA molecule has the sequence 5'-AUGCCACGAGUUGAC-3'. What amino acid sequence does this code for? To answer the question please: 1) explain what is the genetic code and list the properties of the genetic code; 2) draw a diagram of protein synthesis;

10. A portion of an mRNA molecule has the sequence 5'-AUGCCACGAGUUGAC-3'. What amino acid sequence does this code for? To answer the question please: 1) explain what is the genetic code and list the properties of the genetic code; 2) draw a diagram of protein synthesis;

Human Anatomy & Physiology (11th Edition)

11th Edition

ISBN:9780134580999

Author:Elaine N. Marieb, Katja N. Hoehn

Publisher:Elaine N. Marieb, Katja N. Hoehn

Chapter1: The Human Body: An Orientation

Section: Chapter Questions

Problem 1RQ: The correct sequence of levels forming the structural hierarchy is A. (a) organ, organ system,...

See similar textbooks

Related questions

Q: 7) Describe in detail the mechanism by which the major spliceosome removes introns from pre-mRNA…

A: Spliceosome is a complex small nuclear RNA protein molecule also called snRNA that helps to remove…

Q: 4. Which mRNA sequence complements the DNA sequence below? (LS1-1)

A: DNA is a polynucleotide strand. DNA is transcribed into RNA and RNA is translated into proteins.…

Q: If the base sequence of template strand reads GCCATTAC, what is the base sequence of the mRNA? O A)…

Q: occasionally, an effor occurs during DNA replication that changes the nucleotide sequence. Aven that…

A: The process by which DNA is copied to RNA is called transcription, and that by which RNA is used to…

Q: 1. Assume that the ribosome has just catalyzed the formation of a peptide bond, but the ribosome has…

A: Translation of the nucleotide bases sequence in the mRNA to the amino acids results in the formation…

Q: 6. Please describe the events that may result in a mature protein not having methionine as the…

A: DNA is the carrier for genetic information in almost all organisms except certain RNA viruses. DNA…

Q: the gene above is transcribed into a functional mRNA, a.) how many codons will be carried by the…

A: The process of formation of messenger RNA with the help of template strand of DNA is called…

Q: 1. If the gene above is transcribed into a functional mRNA, a.) how many codons will be carried by…

A: a) 64 codons will be carried by the functional mRNA, 61 represent amino acids, and the remaining…

Q: 1. Determine what is being meant by each statements: a. It describes mRNA that results in a single…

Q: 10. (a) What are exon and intron? Explain the process of RNA splicing to highlight that different…

A: Given: RNA splicing is a molecular biological process in which newly synthesised MRNA transcribed…

Q: 1. Label the diagram below with the following terms: O DNA Ribosome MRNA Transcription tRNA…

A: Transcription and translation are the components of gene expression. These two processes are known…

Q: 1- Please write any MRNA sequence that produces protein sequences of 'INFRMATICS'. By using your…

A: Hi! Since you have posted multiple questions and have not mentioned which to answer, we will answer…

Q: 7 Which of the following is the correct polypeptide chain for the mRNA strand shown below?…

A: A codon is a group of three nucleotides in an mRNA grouped to code for a particular amino acid. The…

Q: 3’ G G A U A C G U C A C C G G U A U A A G G U U U C G U A U C G 5’ If the RNA synthesized above is…

A: Codon It is the three consecutive sequence of a mRNA that code for amino acid.

Q: 1. What are the types and major functions for each type of RNA?

A: NOTE: Since you have asked multiple question, we will solve the first question for you. If you…

Q: 5’GCTATAAAGCGTATCGCGTCATA 3

A: Complementary mRNA 5’GCT ATA AAG CGT ATC GCG TCA TA '3 3'CGA UAU UUC GCA UAG CGC AGU AU '5

Q: 8) Which of these describes the function of RNA polymerase? A. Amplifies the “message" by making…

A: Need to find which of the following is correct regarding RNA polymerase function.

Q: 2. Identify the following structures when given images such as the ones below: ● process of…

A: Introduction The cell is the basic structural and functional unit of life present in all living…

Q: 1) A segment of DNA has the following sequence of bases ...5'-ATGCAATGATATTGAAGCTTA -3'... a.) what…

A: Transcription is defined as the synthesis of mature mRNA from antisense DNA template. Translation…

Q: 1. What mRNA sequence is synthesized from a section of DNA that is 3’-TTGACCT-5’?

A: We’ll answer the first question since the exact one wasn’t specified. Please submit a new question…

Q: 3. Label the illustration below using the following terms: DNA, MRNA, codon, transcrip translation,…

A: All the living organisms contain genetic material. The genetic material is responsible for passing…

Q: 1.What is corresponding amino acid chain of the mRNA sequence AUG-CGU-UCU-GCU GGU-UAG? 2. What are…

A: Eukaryotes and Prokaryotes store genetic information in form of DNA and RNA. Some of them have…

Q: 1. In the DNA sequence, the bottom strand is a template strand. If the base pair G-C (in bold) is…

A: Transcription is a process which involves formation of RNA molecules from DNA. One of the DNA strand…

Q: 3. On the diagram below, draw how the mRNA is translated into a peptide beginning with the third…

A: This question we have to describe about process of translation.

Q: 2. Describe the process that is occurring in this image protein nibosome

A: The proteins are the final product of a gene that perform all the functions within the cell.…

Q: Briefly describe the function of the following in protein synthesis: a) rRNA, b) tRNA c) mRNA

A: Ribonucleic acid (RNA) is a genetic material that is prepared from the deoxyribonucleic acid (DNA)…

Q: Which of the following statements about mRNA is correct? a. Eukaryotic mRNA is generally…

A: Introduction:- Ribonucleic acid (RNA) is a nucleic acid that has structural similarities to DNA and…

Q: Write out the protein sequence (the amino acids, in order) encoded by the mRNA sequence:…

A: Amino acid for AUG is Methionine Amino acid for CGA is Arginine Amino acid for CCU is Proline Amino…

Q: ii) If the nucleotide indicated by the highlighted bold letter undergoes a mutation that resulted in…

A: A gene is a functioning heredity unit made up of DNA that provides instructions for the creation of…

Q: 1. What is meant by the term ‘redundancy’ in the context of the genetic code? b) What are the…

A: Answer: DNA sequence is the sequence of nucleic bases arranged in an order which can able to read…

Q: 2. Below is a short segment of a DNA molecule. Translate the DNA codon into MRNA.…

A: The double-helical structure of DNA was transcribed into mRNA molecules and these mRNA molecules are…

Q: 7. Explain how you would determine whether a single chain of nucleotides is RNA or DNA.

A: 7. In all living organisms, the material that contains the information which is transmitted from…

Q: 1. Identify the name of the correct amino acid that corresponds to the correct tRNA codon and mRNA…

A: The process of the formation of the mRNA from the DNA is called as transcription. The process of the…

Q: SOURCE: GENERAL, ORGANIC AND BIOLOGICAL CHEMISTY by Smith 4th Edition

A: mRNA or messenger RNA is a polymer of ribonucleotides that has a sequence corresponding to the…

Q: 1. What is the production of RNA called and what is the enzyme that catalyzes the process?

A: Apologies. We only answer one question at a time. We will answer the first one as the exact one…

Q: 9. What is the purpose of the following? a) spliceosomes b) RNA polymerase c) Protein release…

A: The central dogma of molecular biology involves the processes of transcription and translation that…

Q: 5’ AGGATCAACACCTGTACATGG 3’ 3’ TCCTAGTTGTGGACATGTACC 5’ Label the sense and antisense strands…

A: DNA is ladder like , helical structure which have ability to form its own copies via DNA replication…

Q: 3. Finally, directly below the mRNA sequence that you wrote for #2, write the amino acid sequence of…

A: The DNA sequence given in the question would act as a coding stand for the synthesis of mRNA. The…

Q: How many codons are there in the mRNA?

A: Here, the given original DNA sequence is: 5'ATGCCTGGACGCAATGCGAGCTGGCTTAACTCAGGGCGTTGA3' So,the mRNA…

Q: 1. Using the genetic code, determine the sequence of amino acids encoded by the mRNA codocn sequence…

Q: 9. What is the role ol RNA polymerase? To answer the question please: 1) name three types of RNA in…

A: RNA: It is made up of repeating strands of nucleotides which contain all the three parts (nitrogen…

Q: 2. (a) Consider Amino Acid Sequence 2. How is Amino Acid Sequence 2 different from Amino Acid…

A: The explanation is given below.

Q: 1. Decoding mRNA into amino acids is called translation.

A: above given statements are about transcription, translation process and how amino acids makes a…

Q: Illustrate the process of transcription by providing the correct bases for mRNA strand given the DNA…

A: Transcription is the process where the genetic information on the DNA strand is transferred into an…

Q: 5. For each statement, choose the letter that applies the best: P for prokaryote, E for eukaryote, B…

A: Prokaryotes are characterized by the absence of nucleus and membrane bound organelles of eukaryotes…

Q: 4. Which MRNA sequence complements the DNA sequence below? (LS1- 1) * A C SUP Sequence A O Sequence…

A: The DNA molecule in the cell stores the genetic information of the organism. But this information by…

Q: 6. [1] Given the DNA strand, GGACTGATT which of the following is its complementary mRNA? a CCTGACTAA…

A: Transcription Transcription is a process in which the DNA(deoxyribonucleic acid) is transcribed into…

Q: The role of mRNA in protein synthesis is that it ____.

A: Proteins synthesis is the most important essential and significant metabolic activity of the living…

Q: 1) The direction of transfer of genetic information in all living things (as defined in the central…

A: it is the process of conversion of the DNA into the functional product it explains how genetic…

Question

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

This is a popular solution!

SEE SOLUTION Check out a sample Q&A here

Step 1

VIEW

Step 2

VIEW

Trending now

This is a popular solution!

Step by step

Solved in 2 steps with 1 images

SEE SOLUTION Check out a sample Q&A here

Similar questions

3. (i) Referring to the genetic code (the codon usage table), what would be the amino acidsequence of the polypeptide encoded by the following mRNA sequence?5’ AUGGUGGCCUAUCAUUAGGGGCUU 3’(ii) What would be the effect on translation of the above sequence of a single base (point)mutation which gave rise to an A instead of a U at the twelfth base?(iii) What would be the effect on translation of the sequence in (i) above, if an extra Cwere inserted between the third and fourth bases, i.e., between the two Gs at position 3and 4?
A segment of DNA has the followimg sequence of bases.. 5'-ATGCAATGATATTGAAGCTTA-3' a) What sequence of bases would appear in mRNA transcribed from this segment? b) Assume the first base in this mRNA is the beginning of a codon. What order of amino acid would be translated into a polypeptide synthesized along this segment? c) Give anticodons for each tRNA associated with the translation in part (b)
Given the following Wild Type and Mutated DNA sequences: 1.) Identify where the base pair change occurs ( what letter changed?) 2.) For BOTH sequences, write the mRNA strands, define the codon regions and amino acid sequences. 3.) Describe what kind of mutation has occurred (missense, nonsense, or silent), and what effect this may have on the protein. Wild Type DNA Sequence: 3' - AGGCTCGCCTGT - 5' Mutated DNA Sequence: 3' - AGTCTCGCCTGT - 5'
Given the following Wild Type and Mutated DNA sequences: 1.) Identify where the base pair change occurs (what letters changed?) 2.) For BOTH sequences, write the mRNA strands, define the codon regions (with spaces), and amino acid sequences. 3.) Describe what kind of mutation has occurred (missense, nonsense, or silent), and what effect this may have on the protein. Wild Type DNA Sequence: 3' - CCTCGTTATGTG - 5' Mutated DNA Sequence: 3' - CCTCGTTATTTG - 5'
Considering the given sequence of nucleotides in an mRNA molecule, (a) what is the sequence of the DNA template strand from which the RNA was synthesized? (b) What peptide is synthesized by this mRNA sequence? 5' GAG CCC GUA UAC GCC ACG 3'
30 A DNA sequence encoding a five-amino acid polypeptide is given below. …ACGGCAAGATCCCACCCTAATCAGACCGTACCATTCACCTCCT… …TGCCGTTCTAGGGTGGGATTAGTCTGGCATGGTAAGTGGAGGA… b)Give the sequence and polarity of the mRNA encoding the polypeptide.
A) Based on the mRNA sequence below, provide the corresponding DNA template (5'-3') and protein sequences (N-C terminus) using the single letter abbreviations for each 5' GCA UAU CCU UGU GAU 3' B) Identify the two unique amino acids in the protein sequence above, provide their full names and brief explanation why you chose them C) Draw the two amino acids from 3. connected with a peptide bond to each other (with free amino and carboxy termini) at physiological pH|
Consider a template strand of DNA with the following sequence: 3 '–CAA TGT ATT TTT GCT–5 '. (a) What is the informational strand of DNA that corresponds to this template? (b) What mRNA is prepared from this template? (c) What polypeptide is prepared from the mRNA?
5. a) Describe, using a diagram or point form notes, what is happening during transcription and translation of protein synthesis. Indicate where these events take place in the cell. b) An error occurs in the transcription of the original master strand of DNA. At the very first base pair, a guanine is substituted for cytosine. State the possible effects on the polypeptide and its functions.
30 A DNA sequence encoding a five-amino acid polypeptide is given below. …ACGGCAAGATCCCACCCTAATCAGACCGTACCATTCACCTCCT… …TGCCGTTCTAGGGTGGGATTAGTCTGGCATGGTAAGTGGAGGA… b)Give the sequence and polarity of the mRNA encoding the polypeptide. Please explain step-by-step how exactly you go from the DNA sequence given to the final answer.
Original sequence: Consider the following coding 71 nucleotide DNA template sequence (It does not contain a translational start): 5’-GTTTCCCCTATGCTTCATCACGAGGGCACTGACATGTGTAAACGAAATTCCAACCTGAGCGGCGT GTTGAG-3’ Question: 4) In a mutant you discovered that the underlined nucleotide has been deleted. What would the resulting peptide sequence be? What type of mutation is this? 5’-GTTTCCCCTATGCTTCATCACGAGGGCACTGACATGTGTAAACGAAATTCCAACCTGAGCGGCGT GTTGAG-3
1e) Give the sequence of every codon this tRNA, with the anticodon 5'AGG3', could base pair with (perfect and wobble matches), and name the amino acid coded for by each codon whose sequence you have written.