2. The types of intramolecular bonds in nucleic acid include the following EXCEPT: A. Hydrogen Bond B. Electrostatic interaction C. Phosphodiester bond D. Glycosidic bond
Q: 5. Consider the following DNA template strand: 3’ GCA- AAA-CAA-ATA-GTG 5’ Using the following…
A: DNA or deoxyribonucleic acid is a polymer of deoxyribonucleotides connected together via a…
Q: 3. A molecule with the following composition is replicated in a solution of adenine nucleoside…
A: Replication is a process of DNA dependent DNA synthesis. The process of replication is catalyzed by…
Q: 2. If one strand of a DNA molecule has the base sequence5′-AGCATTAAGCT-3′, what is the base sequence…
A: The deoxyribonucleic acid (DNA) is a hereditary material that is found in almost all living…
Q: How can you modify your DNA model to reflect changes among DNA molecules?
A: Hello. Since your question has multiple parts, we will solve the first question for you. If you want…
Q: 3. Which of the following two molecules of DNA melts (into single strands) at a lower temperature…
A: Melting of double-stranded DNA into single strands depends on the GC content of DNA that is number…
Q: 2. What polypeptide will be created from the following strand of DNA? DNA A T. T A C A C MRNA AA
A:
Q: 5. The nucleotide sequences of the DNA molecules in the figure below were obtained from four…
A: Deoxy ribonucleic acid (DNA) is the genetic material that contains coded genetic sequence in the…
Q: 7. What is the base sequence, specified in the 5' to 3' direction, for a segment of newly formed DNA…
A: The genetic material in most organism is double stranded DNA with the two strands running in…
Q: 5'- What will be the Sanger products of the DNA with base sequence ACGTCGACTCCGGTC-3'
A: DNA sequencing is the biochemical method used for determining the order of nucleotide bases, A, G,…
Q: 2. Another kind of mutation is the so-called frameshift mutation, caused by an insertion or a…
A: Frame shift mutation occurring due to insertion or deletion of single nucleotide will lead to shift…
Q: 3. The following segment of DNA is the template strand: 5'-.GACATGGAA.-3' a. What is the sequence of…
A: DNA and RNA are are nucleic acids present in the organisms. DNA is the deoxy ribose nucleic acid…
Q: #1 under Identify the Structures is what.... A. original strands of DNA B. backbone of DNA C.…
A: The deoxyribonucleic acid (DNA) is the double-stranded molecule which is the genetic material in…
Q: 4. Is there any situation in which DNA is made based on a RNA template? If there is, explain with an…
A: Note: We will answer the first question since the exact one was not specified. Please submit a new…
Q: 3. Which of the following processes involves DNA ligase? A. Primer synthesis B. Removal of DNA…
A: DNA is called deoxyribonucleic acid. DNA act as genetic material in most organisms. DNA is a…
Q: 2. The percentage composition of a nucleic acid molecule found in bacterial cells is 32.3% adenine,…
A: Nucleic acids are polymers whose monomeric units are called nucleotides. Nucleotides have three…
Q: 1. During the replication of a DNA molecule, separation or "unzipping" of the DNA molecule will…
A: DNA, is generally a give a short term for deoxyribonucleic acid, is the molecule which contains the…
Q: 3. For this short DNA segment, a. identify the 5' end and the 3' end of the molecule. b. circle the…
A: Since you have asked multiple questions, we will solve the first question for you. If you want any…
Q: 1. Predict the following sequences of base in the DNA strands complementary to the single DNA…
A: DNA is a polymer of nucleotides attached together via phosphodiester bonds. DNA acts as genetic…
Q: Identify the Structures is what? A. original strand of DNA B. DNA backbone C. nitrogen bases…
A: J.D Watson and F.H.C.Crick(1935) proposed a double helix model of DNA molecule, this is the widely…
Q: 2. In the space below, the two parallel lines indicate a section of double-stranded DNA that is…
A: 5' - 3' direction alludes to the direction of nucleotides of a solitary strand of Deoxyribose…
Q: 2. Describe what is meant be the antiparallel arrangement of DNA.
A: The double helix model of DNA was the famous and most valuable discovery by Watson and Crick. This…
Q: 1. Below is the base sequence of protein for normal hemoglobin and the base sequence for the sickle…
A: 1. Below is the base sequence of protein for normal hemoglobin and the base sequence for the sickle…
Q: In the DNA double-helix structure, the larger of the two grooves formed by the helical twist where…
A: These grooves arise in DNA molecules because the glycosidic bonds of a base pair are not…
Q: We often think only of DNA and RNA as nucleic acids. Discuss the role of other, less “well-known”…
A: 1. The role of cAMP is used for intracellular signal transduction , such as transferring into cells…
Q: 4. If the structure of a fully relaxed, closed-circular DNA molecule is changed so that the specific…
A: DNA is double helical structure which negatively super coil around positively charged histone…
Q: 0. The two strands of DNA that make up the double helix are held to each other by … a)…
A: The correct option is A hydrogen bonds between guanine / cytosine, and thymine / adenine
Q: 3. Which of the following represents a similarity between RNA and DNA? A. The presence of Uracil…
A: DNA and RNA are both very essential biopolymers that sustain life. It is present in all forms of…
Q: 2. Suppose the following base sequence was found in a 20-base DNA polymer.…
A: DNA It is a nucleic acid that constitutes two polynucleotide chains that are complementary in…
Q: 3’atgtaccatgcgcaaatttaaaggccc5’. a) Using this single template strand of a DNA as a template, write…
A: Deoxyribonucleic acid (DNA) is a biomolecule found in nearly all living organisms. The structure of…
Q: 1. What is the first codon in the mRNA strand? 2. The second codon in the DNA double helix is TAT…
A: The DNA (deoxyribonucleic acid) that forms the genetic material of an individual contains…
Q: Both DNA polymerase (any DNA polymerase) and ligase catalyze the formation of a bond between…
A: Polymerase chain reaction used to make thousands of copies of DNA from very small amount of the DNA…
Q: 3. For each of the following characteristics, list all of the bases (A, B, C, or D) to which they…
A: A molecule that consists of Nitrogen and possess the chemical property of a base, is known as a…
Q: 3) Erwin Chargaff is considered one of the pioneering scientists in the field of molecular biology.…
A: According to the Chargaff’s Rule, DNA consists of nucleotides and contains nitrogen bases (Adenine,…
Q: Unlike bacterial cells, the nucleus of a eukaryotic cell is bounded by a double-layered membrane…
A: Cells are the most fundamental and essential unit of life in all living things. All of life's…
Q: 9. The hydrogen bonds and ring-stacking interactions that hold a DNA double helix are individually…
A: Nucleic acids are one of the major macromolecules present in every cell. These large molecules are…
Q: ATT CGG TCG CGC TTA ACG
A: DNA stands for deoxyribonucleic acid which is the most prominent way of storing information among…
Q: 3. What are the last three of six nucleotides (bases) of the palindromic site for the enzyme Ndel if…
A: Restriction endonucleases (or restriction enzymes) are enzymes that identify specific sequences in…
Q: 4. Discuss and detail reasons why eukaryotic organisms appear to have more DNA than is necessary to…
A: The coding sequences of Eukaryotic DNA is called exon and the non coding sequence of Eukaryotic DNA…
Q: 1. Which of the following are generated due to the twisting of dsDNA? a. Hydrophobic bonds b. Van…
A: DNA acts as genetic material in most organisms. DNA is a double-helical structure in which two…
Q: 25.) The area indicated by the arrow is the A) sugar-phosphate backbone B) minor groove C) major…
A: Deoxy ribonucleic acid (DNA) is the genetic material that contains genetic material in the form of…
Q: 6. In the DNA structure below, indicate a hydrogen bond, a phosphodiester bond, a 5' phosphate and a…
A: DNA is the molecular term for the molecule in all living organisms that conveys genetic code. The…
Q: 3,Compare the free energy, ∆G, of A-T binding and A-C binding, which one is more negative? Does this…
A: INTRODUCTION The discovery of DNA as a genetic material and its double helical structure led to ...…
Q: 3. If one measures a 20 ul sample of DNA with an absorbance reading at A280 mm of 0.35 and an…
A: Introduction :- DNA ( Deoxy ribonucleic acid ) is made up nucleotide units , which are made up of a…
Q: 5. Create the complimentary strand for the DNA strand below. Make sure to label the parts and…
A: The base pairing rule of DNA is purine always pairs up with pyrimidine. Adenine(A) and Guanine(G)…
Q: Regarding the triple DNA code, which of the following statements is true?
A: The genetic code refers to the set of rules that all living organisms use to encode information,…
Q: If a DNA triplet is CGA A. What is the mRNA codon? B. What is the tRNA anticondon? C. What amino…
A: According to guidelines we have to answer the first question only. so please kindly post the…
2. The types of intramolecular bonds in
A. Hydrogen Bond
B. Electrostatic interaction
C. Phosphodiester bond
D. Glycosidic bond
3. What intermolecular bond has the greatest influence on the coiling of DNA to the histone complex?
A. Electrostatic interaction
B. Covalent bond
C. Van der Waals interaction
D. Phosphodiester bond
Trending now
This is a popular solution!
Step by step
Solved in 3 steps
- 6. Which of the following DNA sample composition is expected to have the highest boiling point?A. 60% GC pair and 40% AT pairB. 50% GC pair and 50% AT pairC. 80% GC pair and 20% AU pairD. 20% GC pair and 80% AU pair7. What is the sequence following compounds in terms of increasing solubility to dilute methanol solution?A. Adenine → Adenosine → Adenosine monophosphateB. Adenosine monophosphate → Adenosine → AdenineC. Adenine →Adenosine monophosphate → AdenosineD. Adenosine diphosphate → adenine → Adenosine triphosphate6. Which of the following DNA sample composition is expected to have the highest boiling point?A. 60% GC pair and 40% AT pairB. 50% GC pair and 50% AT pairC. 80% GC pair and 20% AU pairD. 20% GC pair and 80% AU pair7. What is the sequence following compounds in terms of increasing solubility to dilute methanol solution?A. Adenine → Adenosine → Adenosine monophosphateB. Adenosine monophosphate → Adenosine → AdenineC. Adenine →Adenosine monophosphate → AdenosineD. Adenosine diphosphate → adenine → Adenosine triphosphate8. Which RNA molecule is NOT involved in the processes of transcription and translation?A. Messenger RNAB. Transfer RNAC. Ribosomal RNAD. Micro-RNA 9. Which of the following functional groups promote the separation of nucleotide fragments in gel electrophoresis?A. Phosphate groupsB. Ribose moietiesC. Purine basesD. Pyrimidine bases10. How many nucleosomes are there in 6 solenoids?A. 10B. 42C. 36D. 501. It is a large complex ribonucleoprotein particle that chemically modifies the pre mRNA strand by the removal of introns 2. This is a linkage between paired bases in the secondary DNA structure 3. It refers to the linkage between 2 nucleotides in the DNA molecule 4. Give the range of the number of nucleotides present in a single protein molecule 5. Identify the number of bases included in the nucleosome 6. It is an enzyme that cuts the bacterial plasmid at its cleavage site
- 4. On a single-stranded DNA, the basic units are linked to one another by A. Disulfide linkages B. Phosphoanhydride bonds C. Phosphodiester bonds D. Hydrogen bonds E. Hydrophobic interactions2. The percentage composition of a nucleic acid molecule found in bacterial cells is 32.3% adenine, 30.7% thymine, 19.1% cytosine and 17.9% guanine. The molecule is most likely to be: a. Double-stranded DNA b. Mitochondrial DNA c. Messenger RNA d. Double-stranded RNA e. Single-stranded DNA1. Which of the following rules apply to the synthesis of nucleic acids? A. Nucleotides are added to the 5' end of nucleic acids. B. Complementary pairing between bases is required for copying nucleic acids. C. The synthesis of nucleic acids cannot occur without the presence of an enzyme to catalyze the reaction. D. Strands are synthesized in a parallel direction such that one end of the double-stranded product has the 3' ends and other has the 5' ends. 2. Why does it take three turns of the Calvin cycle to produce G3P, the initial product of photosynthesis? A. To produce RuBisCo as an end product. B. To fix enough oxygen to export one G3P molecule. C. To fix enough carbon to export one G3P molecule. D. To produce ATP and NADPH for fixation of G3P. 3. For protein synthesis, an amino acid needs to be attached by its _ group to the _ of the tRNA molecule. A. A. Amino; phosphoryl group on the 5'-end. B. Carboxyl; hydroxyl group on the 3'-end. C. Carboxyl; hydroxyl group on the 5'-end. D.…
- 3. translate the following sequence of messenger RNA nucleotides in a sequence of amino acids forming part of a polypeptide chain a. C-U-G-U-U-U-U-G-C-A-G-U-G-G-U-U b. write the sequence of nucleotides for the portion of a DNA molecule that served as a pattern or template for the formation of the messenger RNA above. c. A certain protein contains the following sequence of amino acids: isoleucine-serine-arginine-glutamic acid-serine-proline-valine-glutamic acid. Using the table found in your text, write the sequence of RNA triplet that would code for this sequence of amino acids. then write the sequence of DNA triplets that would code for the formation of RNAThe best definition of an endonuclease is that it hydrolyzes A. nucleotide from only the 3' -end of an oligonucleotide . B. nucleotide from either terminal of an oligonucleotide. C. phosphodiester bond located in the interior of a polynucleotide . D. bond only in a specific sequence of nucleotides. E. bond that is distal co the base chat occupies the 5' position of the bond2. Suppose the following base sequence was found in a 20-base DNA polymer. C-A-G-T-T-A-A-G-G-T-C-C-T-A-G-G-T-T a. What would be the bases in the complementary strand of DNA? b. What would be the mRNA strand transcribed? c. What would be the corresponding tRNA anticodons? d. What are the amino acids coded by the transcribed mRNA?
- 17. Mutation can be caused by the alternative base pairing that arise due to tautomerization and deamination of cysteine and adenine. Draw the alternative base pairing. The thymine dimers can be formed by UV radiation. Alternate base pairing with enol tautomer of T Alternate base pair with deaminated A Thymine dimers due to UV radn (draw structure below) repaired by the enzyme Methylated cytosine and adenine in mismatch repair2. Shown below are two nucleosides. NH₂ HO Ko OH i НО. HO OH NH₂ N a. Name the above nucleosides i and ii. b. Describe how the sugar-phosphate backbone of a DNA molecule can be formed and how a double-stranded DNA can be formed. c. What is the function of DNA in a cell?3. For this short DNA segment, a. identify the 5' end and the 3' end of the molecule. b. circle the atoms that comprise the backbone of the nucleic acid chain. c. write the nucleotide sequence of this DNA segment. P-OCH, CH, HN OP-OCH, NH, OCH, OH 4. A DNA strand has the sequence ATGGCAATCCTCAAACGCTGT a. What is the sequence of the complementary DNA strand? b. What is the sequence of the mRNA that would be produced during transcription from the original strand of DNA? 5. Write the codon on mRNA that would pair with each tRNA anticodon. a. UUG b. GAA c. UCC d. CAC