2.2 Study the diagram below. STAGE Y yright reserved Molecule X STAGE Z 72 34 C 67 u A/C 13 u A C A Organelle B G T 456 AGC acs 5 6 7 8 9 10 11. 12 T 7 T 8 A C 9 10 11 G T 724 CUA S u Structure W JCA 2.2.1 Name the process represented in the diagram above. Translation 2.2.2 Identify: 2.2.3 Give the sequence of nitrogenous bases for the first codon on molecule X (1, 2, 3). 2.2.4 Give the correct order in which molecules P, Q, R and S would attach to molecule X. (From left to right) 2.2.5 Where in a cell does stage Z occur?

2.2 Study the diagram below. STAGE Y yright reserved Molecule X STAGE Z 72 34 C 67 u A/C 13 u A C A Organelle B G T 456 AGC acs 5 6 7 8 9 10 11. 12 T 7 T 8 A C 9 10 11 G T 724 CUA S u Structure W JCA 2.2.1 Name the process represented in the diagram above. Translation 2.2.2 Identify: 2.2.3 Give the sequence of nitrogenous bases for the first codon on molecule X (1, 2, 3). 2.2.4 Give the correct order in which molecules P, Q, R and S would attach to molecule X. (From left to right) 2.2.5 Where in a cell does stage Z occur?

Name: Please asap 2.2Study the diagram below.STAGE Yyright reservedMolecule
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: Please asap 2.2Study the diagram below.STAGE Yyright reservedMolecule XSTAGE Z7423CACC13& AOrganelle B4T567AGCacs5 6 7 8 9 10 11.12T T8A9C10 11POLсT12ACUAStructure WCGUUCA2.2.1 Name the process represented in the diagram above. Translation2.2.2 Ident

Biology: The Dynamic Science (MindTap Course List)

4th Edition

ISBN:9781305389892

Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Publisher:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Chapter15: From Dna To Protein

Section: Chapter Questions

Problem 10TYK: A part of an mRNA molecule with the sequence 5-UGC GCA-3 is being translated by a ribosome. The...

See similar textbooks

Similar questions

The coding sequences of Gene F and Gene G are shown by the double-stranded DNA below: Gene F 5' ATGGGAGCACCAGGACAAGATGGATATCATTAG 3' 3' AGTTACCCTC GT GG TCCTGTTCTACCTATAGTAS Gene G Questions: 1. Write down the messenger RNA sequence when Gene F is transcribed. 2. Write down the polypeptide chain when Gene F is completely expressed. 3. Write down the messenger RNA sequence when Gene G is transcribed. 4. Write down the polypeptide chain when Gene G is completely expressed.
Below is the DNA sequence of a patient with overlapping genes (a single mRNA has multiple initiation points for translation) for two different proteins (DADαs and AMA): 5’- GTCCCAACCATGCCCACCGATCTTCCGCCTGCTTCTGAAGATGCGGGCCCAGGGAAATCTCTAACG-3’ 1. Indicate the DNA sequence coding for RNA. 2. Indicate the amino acid sequence of each of them.
Give typing answer with explanation and conclusion The following gene codes for a liver enzyme. Changing the A/T base pair to which of the following would result in a missense mutation? 5’ GCCTAATATGCCCGTATGC(AGC)nCGAATAAAATAGTACGGTCGTCGC 3’ 3’ CGGATTATACGGGCATACG(TCG)nGCTTATTTT ATCATGCCAGCAGCG5’ A. C/G B. T/A C. G/C D. Any of the above E. 2 of the above F. None of the above
O File C:/Users/Admin/Downloads/cbcc9-guided-reading-ch11.pdf o Sign Off o Outlook O New Tab eE broccoli 0/0 2国《 reading-ch11.pdf 會 %00L 14. Complete the following table, which compares late-stage gene regulation mechanisms. MRNA breakdown Initiation of translation Protein processing Description Example
8:52 Protein 1-10092015113603.pdf https:api.schoology.comv1attachment169963839... Name Class Date Section Protein Synthesis pages 148-153) 7-3 SECTION REVIEW In this section you studied the process of pro- tein synthesis. You learned that the informa- tion that DNA transfers to messenger RNA (MRNA) is in the form of a code. When the information is decoded, chains of amino acids, called polypeptides, are formed. Polypeptides During translation, each MRNA codon in turn make up proteins, which direct biochemical pathways and are responsible for cell structure and movement. The genetic code is determined by the arrangement of the nitrogenous bases in DNA and RNA. A code word in DNA consists of a group of three nucleotides. When transcribed into MRNA, each code word, or codon, desig- nates a specific amino acid that is to be placed in the polypeptide chain. More than one codon may code for a particular amíno acid. The MANA sequence AUG serves as an initiator, or "start," codon. Three other…
Consider the following DNA sequence: CATGTGTAGTCTAAA. Address the followin questions: AWrite the sequence of the DNA strand that would be replicated from this one. GTACACATCAGATT 2. White the sequence of the messenger RNA (MRNA) molecule that would be transcribed from the DNA strand. 30 GUACACAUCAGAU00 37 38 39 3. State how many codons the sequence specifies. 40 41 42 43 44 4. State how many amino acids the sequence specifies. 45
Given the following mRNA, write the double-stranded DNA segment that served as the template. Indicate both the 5 and the 3 ends of both DNA strands. Also write out the tRNA anticodons and the amino acid sequence of the protein encoded by the mRNA message. DNA: mRNA: 5-CCGCAUGUUCAGUGGGCGUAAACACUGA-3 protein: tRNA:
Match the terms with the best description. ______ genetic message a. protein-coding segment ______ promoter b. transcription begins here ______ polysome c. read as base triplets ______ exon d. removed before translation ______ genetic code e. occurs only in groups ______ intron f. 64 codons ______ anticodon g. destroys ribosomes ______ RIP h. often causes a frameshift ______ deletion i. enzymatic RNA ______ rRNA j. binds to a codon
A part of an mRNA molecule with the sequence 5-UGC GCA-3 is being translated by a ribosome. The following activated tRNA molecules are available. tRNA Anticodon Amino Acid 3-GGC-5 Proline 3-CGU-5 Alanine 3-UGC-5 Treonine 3-CCG-5 Glycine 3-ACG-5 Cysteine 3-CGC-5 Alanine Which two of them can bind correctly to the mRNA so that a dipeptide can form? a. cysteinealanine b. prolinecysteine c. glycinecysteine d. alaninealanine e. threonineglycine
+1 1 2 4 6. 7 8. 9. Transcriptional stop sequence ТАTА box ATG ТА AUG UAA Here is a diagram of a human gene in the genome. The bar above it is indicating different regions of the gene sequence. 7. Which region or regions contain the sequences that direct splicing? - 8. In which region or regions could a single base pair insertion cause a frameshift mutation (but not because of changed splicing)? - 9. In which region or regions might you find sequences that control the amount of transcription of this gene? + 10. In which region or regions could a single base pair deletion cause the mRNA to be one base pair shorter? - 11. Which region or regions usually contain a sequence that controls the secretion of the protein e product? e
pcc300ATAAADATATAOOTTAA 1. Use the genetic code table and the information in the diagram below to determine the amino acids that would make up the portion of the polypeptide shown. Include information for a key as well. DNA template 3' G CATA ACAGAGGATT-5' al bnsua AMAm pniwollot erfT E transcription s yd bnsita ebitgeqylog s sidmeaze of beae RNA strandUU UAOUOUU A-emoaodin 5'-CGUA AUUGUC UCCUUA- 3' J J JL erit o elinW (s) translation bluow terdt aspnso sigootiwsone polypeptide viemetis ns ebivo19 (d) ent ot etslanT Key:
What is the sequence of the mRNA transcript that will be produced from the following sequence of DNA? The top strand is the template strand, the bottom strand is the coding strand. 5’ – TCGGGATTAGACGCACGTTGGCATACCTCG – 3’ 3’ – AGCCCTAATCTGCGTGCAACCGTATGGAGC – 5’ Enter the mRNA sequence here (pay close attention to the direction of the molecule!): 5'-_____-3'