21. Single nucleotide polymorphisms (SNPS) mutations are rarely fatal. Which of the following is not an explanation of this fact? a. only about 2 % of the human genome codes for proteins b. many genes are not expressed in most cells c. there are two copies of a gene present d. most SNPS do not code for an extremely important part of a protein e. all of the preceding are satisfactory explanations as to why SNPS are rarely fatal.
Q: geneticist happens upon a gene in humans that is not functional and is not currently being expressed
A: Pseudogenes are those which are present in the genome till now but do not perform any function.
Q: smallest unit of genetic material which produces a phenotypic effect on mutation is
A: NOTE:“Since you have asked multiple question, we will solve the first question for you. If you want…
Q: How are Recombinant DNA formed?What is the difference between genetic modification and selective…
A: Recombinant DNA technology is a new approach to modify the genome of a host organism by joining two…
Q: 2. Discuss the use of transposons as mutagens in bacteria.
A: Transposable elements are segments of DNA that can move around the genome. Classification of…
Q: 1. What sequences form most of the human genome? What is their significance in the expression of…
A: The Alu sequence is known form most of the human genome, it is the most frequent sequence and occur…
Q: Although DNA gets all the glory, it’s actually RNA that does most of the work when cells produce…
A: In species, gene expression is a vital and essential process that helps to produce proteins by using…
Q: 24. The human genome may cod 5,000 to 10,000 different proteins a. Every cell contains a different…
A: Genome is the genetic material of an organism, which consists of deoxyribonucleic acid (DNA). It…
Q: 6. How do you know if the halibut you purchased at thesupermarket is really halibut? To identify the…
A: Animals can be barcoded or identified genetically by the method of DNA (deoxyribonucleic acid)…
Q: 4. Compare the DNA sequences of individuals with Alzheimer's disease and their family members. Two…
A: The amyloid beta precursor protein (APP) is coded by the APP gene that is located on the chromosome…
Q: 4) Goats have been genetically modified to produce an anticlotting protein in their milk. The…
A: As mentioned in the question that goats have been genetically modified to produce an anticlotting…
Q: 1. What is the concept of universality of the genetic code? What are the exceptions to this…
A: Introduction The sequence of nucleotides on m-RNA that code for an amino acid is known as genetic…
Q: 1) Define the silent mutation in DNA? 2) What is the codon usage bias? 3) Provide one example of a…
A: Let's consider an example: DNA strand - 5′-TAC AAA ATA CAG CGG-3′ mRNA strand – 5’ AUG UUU UAU GUC…
Q: 2. Another kind of mutation is the so-called frameshift mutation, caused by an insertion or a…
A: Frame shift mutation occurring due to insertion or deletion of single nucleotide will lead to shift…
Q: 1. The definition of a gene is: a. the sum of genetic information in an organism b. a segment of…
A: Defination of the gene :-
Q: what is The entire complement of DNA sequences in an organism.?
A: Genome
Q: 1. What is the complementary strand of sequenced DNA? 2. What is the transcription product of this…
A: Here, template stand is given having direction 3'→5' new complementary strand synthesized in 5'→3'…
Q: The functions ascribed to the genetic material are replication, expression, storage, and mutation.…
A: Genetics is a branch of the biology involved in the study of genes, genetic variation, and heredity…
Q: 3. Explain the differences between a point mutation and a frameshift mutation.
A: Mutation - A mutation is the condition during which there is any damage to the gene / DNA as a…
Q: What are the advantages and disadvantages of mutation?
A: "Since you have asked multiple questions, we will solve the first question for you. If you want any…
Q: 12. The smallest unit of genetic material which produces a phenotypic effect on mutation is A. Muton…
A: 12= Muton is the smallest unit of genetic material which produces a phenotypic effect on mutation.…
Q: 3. A mutation in a DNA sequence produced a new protein with an amino acid sequence that differs from…
A:
Q: 1. Evaluate the statement that "exceptions" exist to the Universal Genetic Code. Examine possible…
A: In every organism information is stored in DNA.The relationship between the sequence of amino…
Q: 19.Examine the following DNA sequence and determine what type of mutation, if any, produced the…
A: Mutations are certain modifications takes place in the sequence in DNA . Mutations is classified as…
Q: 1. Below is the base sequence of protein for normal hemoglobin and the base sequence for the sickle…
A: 1. Below is the base sequence of protein for normal hemoglobin and the base sequence for the sickle…
Q: Look up these mutations 1 by 1… vestigial wings, white eyes, sepia eyes, ebony body. For each…
A: Drosophila, commonly known as the fruit fly has large wings, gray body colour and red eyes as the…
Q: We often think only of DNA and RNA as nucleic acids. Discuss the role of other, less “well-known”…
A: 1. The role of cAMP is used for intracellular signal transduction , such as transferring into cells…
Q: 1. Let's review! The central dogma of molecular biology refers to the process of gene expression.…
A: We’ll answer the first question since the exact one wasn’t specified. Please submit a new question…
Q: 1. Nutritional Genomics is the term used to describe: a. How nutrients affect gene expression b. How…
A: Nutrigenetics is a newly developing field where the "we are what we eat" idiom will get an entirely…
Q: Why is the TP53 called the guardian of the genome?
A: Genome The genome of an organism consist of whole genetic material. The both part of gene coding…
Q: 7. Describe the mutation that causes sickle cell anemia. a. What is the change that occurs in DNA?…
A:
Q: 1. Nutrigenomics is the study of how diet and gene expression interact throug molecular mechanisms.…
A: Epigenetic modifications are alterations in the genes without changing the exact or original DNA…
Q: 7) The Human Genome project cost billions of dollars to complete. What was it and do you think it…
A: For long, many people thought of the Human Genome Project as biology's "moon shot." The United…
Q: The first base in the tRNA anticodon loop is also wobbling, that is one tRNA is able to pair with…
A: The DNA and RNA are composed of nucleotides. The nucleotides can form hydrogen bonds with each other…
Q: 1. In his transformation experiments, what did Griffith observe? a. Mixing a heat-killed…
A: Griffith's experiment, reported in 1928 by Frederick Griffith, was the first experiment suggesting…
Q: 11) How would an organism be impacted by an error in the mRNA sequence? A) DNA would not be…
A: An error in the sequence always results in the wrong aminoacid being produced. Hence option(c) is…
Q: The extraction of DNA is a common procedure in biotechnology research laboratories. Research the…
A: Common DNA extraction methods Different extraction methods result in different yields and purity of…
Q: Why is it that every cell needs to contain the DNA for the entire body when only a few of its genes…
A: Aside from red blood cells and cornified cells, all other cells in the human body contain nuclear…
Q: 1. Determine the effect of the following mutations on the DNA sequence. In each case, the mutation…
A: Any detectable, inheritable, qualitative or quantitative change in genetic material of an organism…
Q: What proportion in the human genome are actual genes? 2. What are tandem repeats?
A: Introduction All of an organism's genetic data is included in its genome. It is made up of DNA…
Q: If we figured out the amino acid sequence of a peptide, could we use that information to find the…
A: Within an interbreeding population, a gene pool is a set of different genes. The term gene pool…
Q: What is meant by ‘annotating’ the genome? How is this done? Which process occurs first? How does…
A: Asked : Genome annotation process and difference from assembly
Q: 4. Evolutionary change due to mutation, resulting from an altered nucleotide sequence (in a cell or…
A: Properties of genetic material Replication, It should be able to generate it's replica It should…
Q: 3. At which step would a mutation lead directly to the formation of an altered gene? DNA is copied…
A: Deoxyribonucleic acid(DNA) is a molecule comprised of two polynucleotide chains coiled around each…
Q: If a DNA triplet is CGA A. What is the mRNA codon? B. What is the tRNA anticondon? C. What amino…
A: According to guidelines we have to answer the first question only. so please kindly post the…
Q: A mutation is a change that occurs in our DNA sequence, either due to mistakes when the DNA is…
A: Option D is the right answer. Mutations occur due to the exposure of certain ionising radiations,…
Trending now
This is a popular solution!
Step by step
Solved in 2 steps
- 1. Given is the 30 nucleotides in the human gene for hemoglobin (the oxygen-carrying protein in the red blood cells): 3’ TAC-CAC-GTG-GAC-TGA-GGA-CTC-CTC-TTC-AGA 5’ a. What is the amino acid sequence based on this mRNA? b. A very important mutation in human hemoglobin occurs in this DNA sequence, where the T at nucleotide 20 is replace with an A. The mutant hemoglobin is called sickle cell hemoglobin and is associated with severe anemia. What is the amino acid replacement that results in sickle-cell hemoglobin?1. If a mutation occurs in a coding region a. it will cause a change or changes in the normal (wild type) amino acid sequence. b. the protein may not form correctly and as a result does not perform the intended function. c. the type of mutation can be a missense mutation if there is some or limited protein function. d. the type of mutation can be a nonsense mutation if there is no protein function. e. all of the above 2. If a mutation occurs in a non-coding region: a. it will cause no change in the normal (wild type) amino acid sequence. b. the protein is unaffected and still functions correctly. c. the type of mutation is called a silent mutation. d. the protein may not form correctly and as a result does not perform the intended function. e. all of the above8. Which of the following gene mutations is most likely to affect correct protein production? The boxes are the exons and the lines are the introns in the gene a. b. C. d. Site 1 Site 2 Explain WHY. 1+ Site 3 Site 4 a two base-pair deletion at Site 1 that removes two "G-C" nucleotide pairs from the gene sequence a single base-pair substitution at Site 2 that changes a tyrosine-encoding amino acid (TAC) to a stop codon (TAA) a single base-pair substitution at Site 3 that changes one alanine-encoding codon (GCC) to another (GCA) a single base-pair insertion at Site 4 that shifts the reading frame for subsequent codons
- 1. A monogenic disease is a disease caused by a mutation in a single gene. For instance, sickle-cell anemia is caused by a mutation in the HBB gene, which codes for the B- globin chain of hemoglobin. The beginning of HBB is shown here: 5'-ATGGTGCACCTGACTCCTGAGGAGAAGTCTGCCGTTACT...-3' A. Translate this HBB sequence into an amino acid sequence. B. In terms of amino acids, what is the result of the sickle cell mutation, wherein the bolded red A is changed to a T? This single mutation causes hemoglobin to aggregate, causing red blood cells to deform into a sickle-like shape rather than the normal “biconcave disk" shape. C. What would happen if the bolded blue A were mutated to at T? (This is hypothetical; it's not a mutation found in sickle-cell disease.)1. How would the following affect BOTH transcription and translation of a particular multi- exon gene in a eukaryotic cell (for each address both transcription and translation of a particular multi-exan gene; also treat each independently): A mutation abolishing kinase activity in TFIIH a. b. A mutation abolishing mRNA binding in the snRNP U1 С. A mutation in aminoacyl tRNA synthetase for isoleucine such that it can't bind ATP (assume there is an isoleucine in the code)8. Which of the following amino acids in hemoglobin accepts proton H+ when red blood cells reach tissues? A. Histidine B. Aspartate C. Asparagine D. Glutamine E. Serine 9. Which region (A to D) of the DNA strands shown can serve as the template for transcription of the region of an mRNA that contains the initial codon for translation of a protein with 300 amino acids? B 5' AGATGCCCТАAGGTCATTGTT 3' 3' TCTACGGGATTCCAGTAACAA 5' C A. Α В. В С. С D. D E. None of the above
- Table of the Standard Genetic Code Middle base 5'- C_-3' UCU Ser (S) |UAU Tyr (Y) UCC Ser (S) UAC Tyr (Y) UCA Ser (S) UCG Ser (S)UAG Ter CCU Pro (P) CAU His (H) CCC Pro (P) CCA Pro (P) CAA GIn (Q) CCG Pro (P) CAG GIn (Q) 5'- _U -3' 5'-_A_-3' 5'-_G_-3' 5'-U_-3' UUU Phe (F) 5'-U_-3' UUC Phe (F) 5'-U_-3' |UUA Leu (L) 5'-U_-3' UUG Leu (L) 5'-C_-3' |CUU Leu (L) 5'-C_-3' |CUC Leu (L) 5'-C_-3' CUA Leu (L) 5'-C_ -3' CUG Leu (L) UGU Cys (C) 5'-_U-3' 5'-_C-3' 5'-_A-3' UGG Trp (W) 5'-_G-3' 5'- U-3' 5'-C-3' 5'-_A-3" 5'- G-3' 5'- U-3' 5'-_C-3' 5- А-3' 5'-_G-3' GCU Ala (A) GAU Asp (D) GGU Gly (G) 5'-_U-3' 5'-C-3' GGA Gly (G)5'-_A-3' GGG Gly (G) 5'-_G-3' UGC Cys (C) UGA Ter UAA Ter CGU Arg (R) CGC Arg (R) CGA Arg (R) CGG Arg (R) ACU Thr (T)|AAU Asn (N) AGU Ser (S) AAC Asn (N) AGC Ser (S) AGA Arg (R) AGG Arg (R) CAC His (H) 5'-A_-3' |AUU lle (1) 5'-A_-3' AUC Ile (1) 5'-A_-3' |AUA lle (1) 5'-A_-3' |AUG Met (M) ACG Thr (T) AAG Lys (K) 5'-G_-3' GUU Val (V) 5'-G_-3' GUC Val (V) 5'-G_-3' GUA Val (V)…5. A mutant strain of Salmonella bacteria carries a mutation of the rho protein t hat has full activity at 37°C but is completely inactivated when the mutant strain is grown at 40°C. (Question # 21; Chapter 8-Genetics: An Integrated Approach). Speculate about the kind of differences you would expect to see if you compared a broad spectrum of mRNAs from the mutant strain grown at 37°C and the same spectrum of mRNAs from the strain when grown at 40°C. Are all mRNAs affected by the rho protein mutation in the same way? Why or why not?23. All of the following are beneficial effects of mutation, EXCEPT: * a. basis for skeletal disease therapy b. resistance to some diseases like HIV c. used to help treat or cure diseases like heart-related problems d. weakens the ability of the leukocytes to fight diseases and infection
- If a gene is mutated, then it may consequently affect the expressed in the central dogma which then may lead to alter the production/function of other bio-molecules. Select one: a. lipids b. carbohydrate С. DNA Ca d. protein Do Is w Wha ( Previous page Next page https:// Jump to... What Mar 13. These m https://bic 2.2A: V MacBook Pro esc n m-wanry ur @ # $ % & 1 2 3 4 6 Q W E Y tab А S D F G caps lock6. Similar to the class notes (Intro to Genetics), a segment of DNA (shown below) contains a promoter segment (the first 9 base pairs), a ribosome binding segment (the next 6 base pairs), and a segment that codes for protein synthesis which is started by the rest of the base pairs. ACTCCATTGAACCATTTCTATGATCCGCTAACG-... TGAGGTAACTTGGTAAAGATACTAGGCGATTGC-... A. When the DNA is induced to be copied to mRNA, the top strand is coding, meaning that the mRNA makes an identical copy of the lower strand (replacing T with U) The mRNA copy starts with the ribosome binding sequence. What is the sequence of the mRNA that will go to the ribosomes? B. What are the first 6 amino acids of the protein that are coded for by the mRNA? C. What would the amino acid sequence be if... i. a transition mutation occurred on the final G in the mRNA? ii. all of the G & C bases in the protein synthesis portion had transition mutations? iii. a point deletion mutation occurred in the ATA sequence (in the lower strand…3. A missense mutation results in the presence of a different amino acid than was encoded by the parental sequence. This type of mutation can have a drastic effect or no effect at all depending on the importance of the amino acid and the type of amino acid that replaces it. Some amino acids are structurally similar and may be able to act as viable substitutes for each other. For example, changing one acidic amino acid to another may not affect the final protein, but changing a polar amino acid to a nonpolar amino acid will likely disrupt the structure. Please explain what mutations occur in HBB gene of abnormal hemoglobin and their effect on the function of the protein.