Plz answer in 10 mints very urgent just tell me correct option plz 3. One repair mechanism for double-strand breaks involves the unwinding of the damaged DNA followed by the invasion of a template that containidentical or highly similar sequences as the damaged DNA.What is the name of this mechanism?Nucleotide excision repairNonhomologous end joiningHomologous recombinationMismatch repair4. A tall coconut tree is crossed with a ch

DNA repair is the correction of incorrect nucleotides or missing nucleotides in a single strand or…

3. One repair mechanism for double-strand breaks involves the unwinding of the damaged DNA followed by the invasion of a template that contaim identical or highly similar sequences as the damaged DNA. What is the name of this mechanism? Nucleotide excision repair Nonhomologous end joining Homologous recombination Mismatch repair

3. One repair mechanism for double-strand breaks involves the unwinding of the damaged DNA followed by the invasion of a template that contaim identical or highly similar sequences as the damaged DNA. What is the name of this mechanism? Nucleotide excision repair Nonhomologous end joining Homologous recombination Mismatch repair

Biology 2e

2nd Edition

ISBN:9781947172517

Author:Matthew Douglas, Jung Choi, Mary Ann Clark

Publisher:Matthew Douglas, Jung Choi, Mary Ann Clark

Chapter14: Dna Structure And Function

Section: Chapter Questions

Problem 17RQ: Which of the following is not a true statement comparing prokaryotic and eukaryotic DNA replication?...

See similar textbooks

Similar questions

The ends of the linear chromosomes are maintained by helicase primase DNA pol telomerase
Which of the following is not a true statement comparing prokaryotic and eukaryotic DNA replication? Both eukaryotic and prokaryotic DNA polymerases build off RNA primers made by primase Eukaryotic DNA replication requires multiple replication forks, while prokaryotic replication uses a single origin to rapidly replicate the entire genome DNA replication always occurs in the nucleus Eukaryotic DNA replication involves more polymerases than prokaryotic replication.
Which of the following is not correct for bacterial conjugation? a. Both Hfr and F+ bacteria have the ability to code for a sex pilus. b. After an F- cell has conjugated with an F+, its plasmid holds the F+ factor. c. The recipient cell is Hfr following conjugation. d. In an HfrF- conjugation, DNA of the main chromosomemoves to a recipient cell. e. Genes on the F factor encode proteins of the sex pilus.
Why are antibiotic resistance markers such as ampR important components of bacterial plasmid cloning vectors? a. The plasmid must have resistance to accept DNA inserts. b. They allow the detection of plasmids that contain an inserted DNA fragment. c. They ensure the presence of the ori site. d. They ensure that the plasmid can be cut by a restriction enzyme. e. They allow identification of bacteria that have taken up a plasmid.
2. One repair mechanism for double-strand breaks involves the unwinding of the damaged DNA followed by the invasion of a template that contains identical or highly similar sequences as the damaged DNA. What is the name of this mechanism? Nucleotide excision repair Nonhomologous end joining Homologous recombination Mismatch repair
10. A picture of a replication bubble is shown below. でイトイOpイ TT 3 Primer 5'-CUU-3" is being used to replicate this picce of DNA. What strand this primer will anneal to: the upper or the lower? Write what product of RNA replication would be the first five nucleotides that had been added onto the primer by DNA pol. Mark the 5' and 3' ends. lin
14. Guanine normally pairs with cytosine. Oxidative damage can result in the modification of guanine to 8-oxoguanine. What is the potential mismatch in nucleotides that can occur following replication? 8-oxoguanine pairs with Adenine 8-oxoguanine pairs with thymidine Thymidine pairs with adenine Guanine pairs with Cytosine None of these choices. Question 8 The key enzyme that transfers an a-amino group from an amino acid to an a-keto acid is : Glutamate Dehydrogenase Transaminase Synthetase Glutamine PRPP Amidotransferase Glutaminase
1. The diagram below depicts a DNA replication fork in a biological cell. The primer is shown by an arrow 5'-3'. A ATTATGTCTGGCCTTGAGTAAGGCTAATCACAT GCGTA GCAT Primer BTAATA TCATTC CGATT From the DNA diagram above, which ends (indicated as A, B, C & D) of the DNA template strand are the 5' and a. which are 3' ends? b. Which way is the direction of movement of the replication fork? Right or left of the figure. Which of the parental strands are the templates for leading (continuous) and lagging (discontinuous) strand synthesis?. Top or bottom strand. С. I d. Give the sequence of the five base long primer that is shown as an arrow in the diagram above 5' 3' Give the sequence of the next four bases that would be added to the growing end of the primer e. 5' 3'
33.Choose the DNA nucleotide sequence that would be complementary to the following strand (note: pay attention to DIRECTION of replication): 5' GTAGTCA 3' a 3' UATUAGA 5' b. 5' TGACTAC 3' 3' ACGACTG 5' 5' UGACUAC 3'. 5.Using agarose gel electrophoresis to analyze DNA, short DNA travels the long DNA. a faster than slower than at the same speed as d. Question 6 Which type of bonds link the individual nucleotides together in DNA? Glycosidic bond Peptide bond Phosphodiester bond Electrostatic bond a e Hydrogen bond Question 7 A typical engineered plasmid vector often contains the following features except a A poly linker region Origin of replication A signal peptide An antibiotic resistant gene a. b. C. C. d.
vvnicn the following statements are correct about the repair of a DNA duplex containing the sequence below that is grown INE coli (select all that apply)? Strand A Strand B GATCTAGCCGGCATCCGAT CTAGATCGGACGTAGGCTA Methyl ✔A. MutH cleaves Strand A O B. DNA repair will result in the bold A in strand B being replaced with a C O C. DNA repair will result in the bold G in strand A being replaced with a T ✔ D. Defect will not be properly repaired in dam(-) E coli O E. The mammalian repair system would also correct the mismatch shown based on the methylation status of the DNA
3 E D C The arrow in the diagram below indicates the direction of movement of the replication fork. 5' S R F Q Search Which letter indicates a strand that is synthesized discontinuously? OA Ов ос V A F5 T C G B F6 T 6 Replication B LDL Y F7 H & 7 WALLS U N F8 * 00 99+ 8 J₁ F9 kirimmi MO 35 Alt מם E K 2 F10 L P < F12 10:05 AM 4/8/2023 Ctrl 10 B
5. The nucleotide sequences of the DNA molecules in the figure below were obtained from four different individuals, one wild type and three mutants. Wild Type 5'-TTATCCATGATCGGATCGATCCATTAGCCGA-3' 3'-AATAGGTACTAGCCTAGCTAGGTAATCGGCT-5’ Mutant I 5'-ATCCATGATCGGATTGATCCATTAGCCGAAT-3’ 3'-TAGGTACTAGCCTAACTAGGTAATCGGCTTA-5’ Mutant II 5'-CCGTTATCCATGATCGGATAGATCCATTAGCC-3’ 3'-GGCAATAGGTACTAGCCTATCTAGGTAATCGG-5’ Mutant III 5'-CACCGTTATCCATGATCGGAACGATCCATTAGC-3’ 3'-CAGGCAATAGGTACTAGCCTTGCTAGGTAATCG-5’ a) Identify the open reading frames in each sequence of DNA and translate them into proteins. Write down the sequence of amino acids that will be obtained after translation: b) Which of the mutations above would be least likely to cause a change in the function of the protein? Why? c) Which of the mutations above would probably cause a major disruption in the function of the protein? Why?