-35 sequence -10 sequence +1 Transcribed lac operon TTTACA N7 TATGTT NG A lacl GCGCAA N7 CATGAT N, Al trp operon TTGACA N7 TTAACT N, A rrnX TTGTCT N16 TAATAT N7 Al TTGATA N46 TATAAT N, A recA lexA TTCCAA Ny7 TATACT NG A TRNA" TITACA N16 TATGAT N, Al Consensus TTGACA TATAAT sequence
Q: The insertion of transposable elements into genes can alter the normal pattern of expression. In the…
A: NOTE:- As you have posted multiple questions under one, we will solve the first part for you, to…
Q: Operons can not be: a. Negatively regulated b. Positively regulated c. Constitutive d. Inducible…
A: The workhorses of a body are proteins. All or every function of the body are carried out by the…
Q: The process in which the two-dimensional structure of RNA from the L region of an operon can either…
A: The strategy of creating an RNA duplicate of a grouping is transcription. The transcript, known as…
Q: What would happen to the regulation of the tryptophan operon in bacterial cells that express a…
A: In E. coli, all the 20 amino acids can be synthesized in vivo by the organism. The genes for the…
Q: . Listed in parts a through g are some mutations that were found in the 5′ UTR of the trp operon of…
A: trp operon: it's found in E coli and it encodes for essential amino acid tryptophan. The trp DNA is…
Q: How does the binding of the trp corepressor and the lac inducer to their respective repressor…
A: "Since you have asked multiple questions, we will solve the first question for you. If you want any…
Q: There are two variants of the enhancer sequence found in people. One has the sequence CACTAAAG, and…
A: Regulatory sequences or elements are the DNA sequences that serve as a binding site for regulatory…
Q: Regarding the process of gene transcription in eukaryotes, it is correct to state that A)The…
A: Transcription is a process of copying a DNA segment into RNA.
Q: . Listed in parts a through g are some mutations that were found in the 5′ UTR of the trp operon of…
A: INTRODUCTION: Tryptophan (trp) operon for the synthesis of the amino acid tryptophan, is an example…
Q: A. A mutation is recovered in the gene that encodes the lactose operon repressor protein (LacI).…
A: Lac operon is a simple prokaryotic group of genes for the metabolism of lactose. It consists of…
Q: When wild-type E. coli are grown in media with high lactose and no glucose, which of the following…
A: The lactose operon (lac operon) is an operon required for the transport and metabolism of lactose in…
Q: Let’s suppose you have isolated a mutant strain of E. coli in which the lac operon is constitutively…
A: E.coli is a gram negative bacterium which thrives in the intestine of mammals. E.coli is beneficial…
Q: A bacterial species has a hypothetical sigma promoter that has the following sequence: TTGGCA -…
A: Promoters are essential components of expression vectors because they regulate RNA polymerase…
Q: A mutant strain of Salmonella bacteria carries a mutation of the rho protein that has fully activity…
A: In bacteria, two transcription termination mechanisms take place. Intrinsic termination, which is…
Q: cAMP binds to cAMP Receptor Protein (CRP), allowing CRP to bind to the promoter of the lac operon
A: Almost all bacteria such as E. coli contains lac operon which operates in utilization of lactose as…
Q: The gad operon is controlled by a number of transcription factors that regulate a promoter of…
A: Bacteria re found in prokaryotes. They are more primitive as compared to eukaryotes.
Q: Name and discuss two transcription regulatory elements that can be found in the figure. (6) 4.2.…
A: RNA polymerase is a main enzyme responsible for the the transcription of RNA by coding complementary…
Q: Which of the following is/are true regarding transcription initiation in bacteria? I. TFIID will…
A: To start transcribing a gene, RNA polymerase binds to the promoter region of the gene's DNA.... The…
Q: Which of the following mutations would result in the highest level of lac operon transcription in…
A:
Q: For each of the following, match with the stage of gene expression being regulated.…
A: DNA and RNA are nucleic acids present in the organisms. DNA is the deoxy ribose nucleic acid whereas…
Q: ou have isolated different mutants (reg1 and reg2) causing constitutive expression of the emu operon…
A: The operon's regulation can take place positively or negatively. If the negative operator is bound…
Q: In lac operon, both gene A and gene B undergo a transcription process. Gene B can only undergo…
A: An operon is a gene regulation mechanism in prokaryotes.
Q: Suppose the tRNA synthetase responsible for attaching tryptophan to tRNA is muted in a bacterial…
A: In order to maintain correct transcription and translation, bacterial operons use attenuation as a…
Q: Under the following conditions, what will be occurring with the lac operon? Glucose: Present…
A: lac operon is present in E.coli and contain genes that control lactose metabolism and only active…
Q: As discussed in the text, promoters were originally identified as consensus sequences upstream from…
A: The promoters are considered as the specific nucleotide sequence that is present in the upstream…
Q: The –35 sequence of a particular bacterial gene is 5′– TTAACA–3′. A mutation changes the fifth base…
A: Genetic codes are triplet, ambiguous, degenerate and non-overlapping. Three bases codes for an amino…
Q: Which of the following mechanisms is an example of post-transcriptional gene regulation? A. binding…
A: The DNA (deoxyribonucleic acid) is the hereditary unit of an organism. It consists of purines and…
Q: What if there was a mutation in the operator region of the lac operon and the active repressor could…
A: We are answering first 2 questions. For the remaining question pls repost.
Q: Which of the following environmental conditions would be MOST likely to result in transcription of…
A: The transcription of the lac Oberon in an E.colicell is high levels of lactose and high levels of…
Q: A disease is caused by having no functional protein produced from the KIP gene. An individual has…
A: The gene expression follow the rules of central dogma that involves production of the final product…
Q: If the above gene is one of the three structural genes of the lac operon that codes for the protein/…
A: Introduction Lactose operon(lac operon) is a system which includes genes that are essential for…
Q: What is one function of TFIIH during transcription? a. Recruiting the TATA-box binding protein…
A: Transcription factor II Human is a crucial protein complex which have important role in…
Q: The phosphorylation of the RNA polymerase II tail is important for the following EXCEPT a.the…
A: Among many subunits, the largest subunit of RNA polymerase 2 (RBP1) has a long carboxy-terminal tail…
Q: Explain how the following mutations would affect transcription of the yeast GAL1 gene in the…
A: The mutation is defined as the change in a sequence of DNA. It will occur when a gene of DNA is…
Q: Which of the following is true about operons? A. Contains a cluster of genes transcribed as…
A: An operon is a functional unit of transcription and genetic regulation, which occur primarily in…
Q: Why is it adaptive for the structural genes for using lactose to be under the control of a single…
A: Each cell can adjust to its surroundings to the best of its abilities. This adaptability is achieved…
Q: For the ovalbumin gene shown, indicate the locations of the following: (a) transcription start site,…
A: The transcription start site is the site on the DNA from which the first RNA nucleotide (+1) is…
Q: In the topic about prokaryotic gene expression regulation, we learned about the LacI-, LacIS, and…
A: The mutation is considered as a way in which there is the occurrence of diversity in genes. The…
Q: Many bacterial genes with related functions are arranged in operons, sets of contiguous genes that…
A: Transcription is the first od several steps of DNA based gene expression in which a particular…
Q: Describe what would happen to the lac operon in a low-lactose environment and in a high lactose…
A: LacZ (encodes beta-galactosidase), lacY (permease), and lacA (trans-acetylase) are the three genes…
Q: A bacterial cell with trp and lac operons in a medium with high concentration of lactose,…
A: The prokaryotic gene regulation is known as operon system which controls the expression of…
Q: Explain how the lac operon is regulated under the following conditions. Include the following terms…
A: Lactose can be broken down by E. coli bacteria, however, it is not their preferred fuel. They would…
Q: A bacterial species has a hypothetical sigma promoter that has the following sequence: TTGGCA - 18…
A: Transcription is the process of creating new RNA by duplicating the DNA strand. Transcription is the…
Q: In the: Mutation of the regulatory region for a repressor protein in the lac operon. Explain: (a)…
A: Operon It is a set of multiple gene that is controlled by single operator.
Q: A high rate of transcription initiation from promoters in bacteria can be achieved by which of the…
A: Transcription can be described as a process by which the information in a strand of DNA is copied…
Q: How do we know that the orientation of promoters relative to the transcription start site is…
A: Transcription is a process in which a sequence of DNA is transcribed into mRNA.
Q: . Listed in parts a through g are some mutations that were found in the 5′ UTR of the trp operon of…
A: The bacterial transcription unit containing more than one gene is known as an operon. An operon has…
Q: . a. How many ribosomes are required (at a minimum)for the translation of trpE and trpC from a…
A: Trp operon is also called as tryptophan operon, a group of genes that encodes biosynthetic enzymes…
Q: With regard to a promoter, a transcriptional start site is a. located at the −35 sequence and is…
A: Transcription is the process of the formation of RNA chains using the template strand of DNA.
Mutations in bacterial promoters may increase or decrease the rate of gene transcription. Promoter mutations that increase the transcription rate are termed up-promoter mutations, and those that decrease the transcription rate are termed down-promoter mutations. As shown , the sequence of the −10 site of the promoter for the lac operon is TATGTT. Would you expect the following mutations to be up-promoter or down-promoter mutations?
A. TATGTT to TATATT
B. TATGTT to TTTGTT
C. TATGTT to TATGAT
Trending now
This is a popular solution!
Step by step
Solved in 2 steps
- 5'-TAGCTGATCGAATATGCGGTCTCTATCTTCGTAGACGA-3' 3'-ATCGACTAGCTTATACGCCAGAGATAGAAGCATCTGCT -5' Determine the amino acids that will be encoded by this sequence Second letter First letter U C A G U UUU Phe UUC UUA UUG Leu CUU CUC CUA CUG Leu GUU GUC GUA GUG Val UCU UCC UCA UCGJ AUU AUC lle AUA ACA AUG Met ACG CCU CCC C CCA CCG ACU ACC GCU GCC GCA GCG Ser - Pro Thr Ala A UGU UACTyr Cys UGC. UAA Stop UGA Stop A UAG Stop UGG Trp G CAC His CAA Gin CAG GAUT GAC Asp GAA AAU Asn ACC Ser AGU AAG LYS AA Glu GAGJ Oa. N-Met-Arg - Ser-Leu-Ser - Ser-C Ob. N-Met-Pro-Arg - Asn-Asp - Ser-C d. N-Met-Lys - Val-Glu-Ala-C Oc. N-Asp-Pro-Lys - Ser - Val-Ile-C Oe. N- Met-Ala-Asp-Pro-Lys - Ser-C G CGU CGC CGA CGG AGA AGG. GGU GGC GGA GGG Arg SCAO Gly U UCAG UUA DUAG Arg G Third letter 13b. Which one of the following a cell mutants will be able to switch at least once? [Select]BM4_DNA AND PROTEIN S X /1FAIPQLSDP_g5B-629FSHNpGnTMIEppLS4A71zBd4vcUBqNUILubXONw/formResponse 4. What is the nitrogen base pair of Adenine in transcription? O Cytosine O Uracil O guanine O thymine 5. The central dogma of Molecular Biology states that There are four nitrogen bases in DNA, two purines (adenine and guanine) and two pyrimidines (cytosine and thymine). Which process is not included in the central dogma? duplication transcription translation O translocation Leadple
- RNA codon table 2nd position A 1st U 3rd position position U Phe Phe Leu Leu Leu Leu C Leu Leu Ser Ser Ser Ser Cys Сys stop Тyr Тyr U stop Trp stop Pro Pro Pro Pro His His Gln Gln Arg Arg Arg Arg lle lle lle Met Thr Thr Thr Thr Asn Asn Lys Lýs Ser Ser Arg Arg Gly Glý Glý Glý A Val Ala Ala Ala Ala Asp Asp Glu Glu Val G Val Val Amino Acids Ala: Alanine Arg: Arginine Asn: Asparagine Asp:Aspartic acid Cys:Cysteine Gin: Glutamine Glu: Glutamic acid Lys: Lysine Gly: Glycine His: Histidine le: Isoleucine Ser: Serine Thr: Threonine Trp: Tryptophane Leu: Leucine Met: Methionine Phe: Phenylalanine Tyr: Tyrosisne Pro: Proline Val: Valine This figure shows the for translating each genetic codon in into an Four "special" codons are the codon: AUG ant the three codons: UAA, UAG, and UGA. The specification of a single amino acid by multiple similar codons is called believed to be a cellular mechanism to the negative impact of random TRUE or FALSE : Each species uses its own genetic code for protein…IG-LA ED What pattern of functional protein synthesis of ß-galactosidase and permease, respectively, would you expect from an I*P*OCZ+Y+ lac operon in the absence of lactose? O ++ O -- O +- O+48 Second letter If any single nucleotide is deleted from the DNA sequence shown below, what type of mutation is this? UUU U UUC UUA UCU Phe UCC UAU UGU Cys ANTISENSE 5' GGACCCTAT3' UAC Tyr UGC UAA Stop UGA Stop UAG Stop UGG Trp Ser UCA Leu UUGL" UCG CUU CU CAU) His CAC) CGU CGC CGA Arg CUC C Leu Pro CAA1 Gin CAG) CUA CCA CUG CG CGG AAU AAC Asn AGC AAA AAG Lys AGG Arg AUU ACU AGU Ser AUC lle ACC Thr AUA ACA AGA AUG Met ACG GCU GCC GUU GAU] GGU GUC Val GAC Asp GGC Ala Gly GUA GCA GAA GGA Select an answer and submit. For keyboard navigation, use the up/down arrow keys to select an answer. a FRAMESHIFT SILENT NONSENSE MISSENSE Third letter First letter
- Design 6 bp primers to amplify the region of this sequence that is highlighted in yellow. attatatttt atattatata ctctgggctc agagcagccc 40 41 atattatata tatatatttt aaaatattat aaatttattt 80 81 cagtcacgcg tcctgatgac attatatttt ataatttttt 120 121 ttttattttt attatatttt aaaatattat aaatttattt 160 161 aaaatattat tatatattta aaatttattt attataaaat 200 201 aaaatattat ttttattttt gagatcagga cggctgcatg 240 Forward primer Reverse primer11c all three of the classes or types of eukaryotic transcriptional regulators have alpha helical structure. name any two of the three major classes of eukaryotic transcriptional regulators.5' UGG CAA UCC UAC GAU 3' - 1. Here is the MRNA sequence from a section of a gene (it is the middle of the sequence, so it has no AUG). What is the template sequence of this gene? - 2. Are any of these codons in the MRNA non-degenerate? If so, indicate which one. e 3. 4 a) Translate this mRNA section. Give the 3 letter codes for the amino acids. b) Indicate on the peptide which is the C terminus and which is the N terminus. e 4. Is it possible for a single base pair substitution to cause a truncation in this peptide? If so, e explain how. e 5. Write out the sequence of the anticodon in the tRNA that would bind to the fourth codon in the e MRNA. e 6. Write out a possible miRNA that could regulate the expression of this gene
- AUU Isoleucine ACU AAU Asparagine AGU Serine U AUC Ile ACC |Threonine AAC AAA AAG Asn AGC Ser |AUA Methionine Lysine Lys AGA Arginine Arg ACA Thr A Met ACG AGG AUG Initiation codon GAU Aspartic acid GAC GCU GCC Alanine GCA GCG GUU GGU GỤC Asp GGC Glycine C G |GUA GUG Valine Val GAA Glutamic acid GAG Ala GGA Gly A Glu GGG G (a) What amino acid will a tRNA be carrying if its anticodon is GGG? Enter its 3-letter code. (b) What amino acid will a tRNA be carrying if its anticodon is UCC? Enter its 3-letter code. (c) What amino acid will a tRNA be carrying if its anticodon is UAU? Enter its 3-letter code. First letter ( Third letterpcc300ATAAADATATAOOTTAA 1. Use the genetic code table and the information in the diagram below to determine the amino acids that would make up the portion of the polypeptide shown. Include information for a key as well. DNA template 3' G CATA ACAGAGGATT-5' al bnsua AMAm pniwollot erfT E transcription s yd bnsita ebitgeqylog s sidmeaze of beae RNA strandUU UAOUOUU A-emoaodin 5'-CGUA AUUGUC UCCUUA- 3' J J JL erit o elinW (s) translation bluow terdt aspnso sigootiwsone polypeptide viemetis ns ebivo19 (d) ent ot etslanT Key:5'- ATTGTGATATGGCCACCTGCCACCTGGAGAGCAGCT GATTAG-3' What oligopeptide is encoded by the above sequence? Please use the one-letter code for your answers. (You will need to consult the Table of the Genetic Code for this question) 1st letter UUU Phe UCU UCC Leu UCA UCG U UUC UUA UUG CUU C CUC CUA CUG AUU A AUC AUA AUG U GUU G GUC GUA GUG CCU Leu CCC CCA CCG ACU lle ACC ACA Met ACG GCU Val GCC GCA GCG с Second Letter Ser Pro Thr Ala UAU UAC A | AAU AAC AAA AAG GAU GAC GAA GAG Tyr CAU CAC CAA Gin CAG 1 UAA Stop UGA Stop A UAG Stop UGG Trp G His Lys UGU UGC Asp Glu G 3rd Asn AGU Ser U letter AGC AGA AGG Cys U CGU CGC Arg CGA CGG GGU GGC GGA GGG DCAG DUAG DUCAG Arg Gly UCAG