4. a. A polypeptide contains 36 amino acids. How many nucleotides should be found in the open reading frame? How many codons are required to produce this polypeptide? b. RNAS play critical roles in various processes in translation. Name the RNA in small subunit of ribosome in E. coli and briefly describe its critical function.
Q: What does the last number in the numeric designation of enzymes refer to?
A: Each enzyme is allocated a four digit EC number,an enzyme Commission number does not specify enzymes…
Q: Please explain gluconeogenesis. What is it? Where does it occur and why?
A: Gluconeogenesis is a very crucial process in organisms. It plays a vital role in providing energy to…
Q: Properties of Body Fluids.
A: "Since you have posted multiple questions, we will answer the first question for you. If you want…
Q: Which of the following is NOT regulated by glucagon?
A: question 1:- Not regulated by glucagon A- GLUT-4- transporter- it is a glucose regulated type…
Q: Draw, label, and explain the three stsges of lipid oxidation
A: Lipid peroxidation may be defined usually as a technique below which oxidants consisting of…
Q: What is the purpose of adding the dishwashing liquid to the DNA extraction?
A: DNA extraction is a method of separating DNA from cell membranes, proteins, and other cellular…
Q: What is the total number of ATP molecules that can be produced from the complete oxidation of one…
A:
Q: Which of the following enzyme catalyzes a reaction that introduces reduced nitrogen ito cellular…
A: Nitrogen metabolism is characterized by the coordinated expression of a large number of enzymes…
Q: Increased protein metabolism leads to increase in which of the following? Select all that apply.…
A: Proteins are made up of amino acids. Protein metabolism involves the breakdown of proteins by…
Q: Discuss the four main mechanisms of antibiotic resistance and factors that promote the emergence of…
A: Antibiotic resistance occurs when microorganisms like bacteria and fungi develop the ability to…
Q: What is the difference between the first steps of DNA sequencing to PCR in terms of the number of…
A: PCR is expanded as a polymerase chain reaction. It is a technique that is used widely for the…
Q: Using the Pearson square technique, determine the amount (lb) of skim milk (assume 0.0% milkfat)…
A: Skimmed milk contains no cream or less fat than regular milk. Typically, it contains just 0.1% fat…
Q: Yeast yields ethanol from pyruvate in two steps. Step one requires the co-enzyme __ , which is…
A: Pyruvate dehydrogenase catalyzes this oxidative decarboxylation of pyruvic acid. Complexity refers…
Q: Which of the following cell types can do glycolysis, anaerobic respiration, glycogen biosynthesis,…
A: Gluconeogenesis is a process that converts non-carbohydrate substrates into glucose.
Q: What is the net change in high energy bonds in the reaction below? Predict the standard free energy…
A: The reaction that is depicted is Succinyl coA+ GDP+ Pi ----> succinate+ coAsh + GTP. This is an…
Q: Which of the following was added RNA extraction? Buffer RPE Wash buffer guanidine-isothiocyanate…
A: DNA molecule is a sritical methd. It helos in serine, nRNa Nither momt tertibre
Q: 8. Which of the following is characteristic of a competitive inhibitor of an enzyme-catalyzed…
A: Enzymes are biological catalysts which play important role catalysis of biochemical reactions.…
Q: Please explain the Warburg Effect and how it is used to detect tumors.
A: Warburg effect is phenomenon commonly used to detect the cancerous cells. The detection of cancer…
Q: What are two important compounds that lie at crossroads of major metabolic pathways? Select both…
A: Metabolic pathway engineering in microbial hosts for heterologous biosynthesis of commodity…
Q: If glycogen is depleted in the liver, which of the following is also occurring? Group of answer…
A: This phenomenon is stated as "hitting the wall". Glycogen depletion may be forestalled in 3 viable…
Q: Given the following information about an enzymatic reaction, calculate the initial velocity. Your…
A: The Michaelis–Menten kinetics of an enzymatic reaction shows the relation between the substrate…
Q: Which of the following enzymes catalyze the ADP-ribosylation of key cellular enzymes or proteins? a.…
A: ADP-ribosylation is a dynamic post-translational conversion of proteins that regulates a variety of…
Q: Removal of phosphoryl groups is catalyzed by ___________ a. Diphteria toxin and cholera toxin b.…
A: The phosphoryl-transfer potential (the standard energy of hydrolysis) compares the proclivity of…
Q: Which of the following is least soluble in hexane?
A: Fatty acids (FA) are aliphatic chain with carboxylic acid group, which is non-polar molecule. This…
Q: a. We have a molecule 2,3-bisphosphoglycerate (BPG), which is a negative allosteric modulator for…
A: Hemoglobin is a protein present in the RBCs, which transports oxygen from lungs to the tissues, and…
Q: Why are vascular tissues important?
A: The vascular tissue system is made up of a number of vascular bundles that are found throughout the…
Q: all dehydrogenase reactions are variations upon a theme. Within that set of reactions, all reactions…
A: Dehydrogenases is an enzyme belongs to the class of oxidoreductase enzyme. In oxidoreductase the…
Q: The metabolic function of the pentose phosphate pathway is to: a. generate NADPH and pentoses for…
A: Pentose phosphate pathway also called the hexose monophosphate shunt is an alternative pathway for…
Q: interphase FISH is used on fixed material from a solid tumour, rather than metaphase FISH
A: Interphase FISH is a new technique introduced into the molecular cytogenetics. it is used to study…
Q: explanations are not needed. Direct answers would suffice. a. Which of the following conditions…
A: The breakdown of glycogen ,to generate glucose is a process termed as glycogenolysis , it occures in…
Q: What will be the effect of mutation that turns lysine to arginine
A: The mutations occur in genomic DNA but they will reflect in the form of protein sequence and…
Q: a. Which of the following is NOT an example of structural polysaccharides? I. amylose II.…
A: Polysaccharides (polycarbohydrates) are the most common carbohydrate found in food. They are…
Q: Which of the following statements about protein digestion are true? Check all that apply. ► View…
A: Proteins are macronutrients, which act as the building blocks of the body. Proteins can also act as…
Q: 2. Isocitrate dehydrogenase is an enzyme of 2 subunits with two active sites, catalyzing the…
A: Metabolism includes biosynthesis/ reduction (an anabolic process) and oxidation (catabolic…
Q: HN Histidine NH₂ OH HN + H |+ H-NH H
A: Enzymes are highly specialized proteins that have extraordinary catalytic power, greater than that…
Q: A DNA codon has the sequence GAT. What is the resulting tRNA anti-codon in the translation process…
A: Codon is a sequence of three nucleotides present in DNA or mRNA (messenger RNA) molecule that…
Q: A) For this DNA fragment "TGAATTCCCGGGTTCCGGGAATTCGCGCGAATTCCCGGTATA", what is its complementary…
A: Deoxyribonucleic acid (DNA) is a nucleic acid that carries genetic information from parent to…
Q: 1. What happens to the rate of liver glucose metabolism during moderate intensity exercise? 2. Would…
A: Carbohydrates are the main energy source for body, they broke down in to glucose as the sole ATP…
Q: ased on the knowledge you gained from the cloning module, which of the lanes in the urs is…
A: Agarose gel electrophoresis is used to separate DNA molecules based on their size and analyze DNA…
Q: product of the reaction:
A: Lipids are biological molecules that are insoluble in water but soluble in non-polar…
Q: The succinyl CoA to citrate pathway of the citric acid cycle is shown. Identify the missing…
A: Succinyl Co-A and the reactions given in the question are part of the TCA cycle. The TCA cycle is a…
Q: Each proton that moves across the membrane releases about 14 kJ/mol of energy. Given that ATP…
A: The ATP synthase in the inner mitochondrial membrane uses the flow of protons into the mitochondrial…
Q: Which of the following best describes the mechanism of action of a cardiac glycoside? A)…
A: Cardiac glycosides are the compounds that are important for enhancing the force of heart to increase…
Q: State the significance of HMP shunt
A: The pentose phosphate pathway is also called the hexose monophosphate shunt pathway.
Q: The synthesis of phosphocreatine is unfavorable. If dur- ng extended periods of rest, e.g., sleeping…
A: Phosphocreatine (PCr) - It is a phosphorylated creatine molecule that works as transferable reserve…
Q: A protein that has been reversibly denatured has Multiple Choice temporarily lost part or all of its…
A: Each protein has its own distinct sequence of amino acids, and the interactions between these amino…
Q: structure of its covalent adduct to DNA
A: Introduction: Chlorambucil is a monocarboxylic acid that is butanoic acid substituted position 4 by…
Q: f. Total number of net cytosolic ATP molecules produced right after glycolysis: g. Total number of…
A: The starch molecules obtained through the diet are degraded to form dextrins, maltose, and…
Q: ACTIVITY 8.1.3 Complete the table Sphingolipid Ceramide Shiphingomyelin Ganglioside Function Name…
A: Introduction: Sphingolipids are complex lipids molecules that contain sphingosine instead of…
Q: Predict which fractions will contain actin and which will contain myosin, and predict the degree of…
A: All types of muscle tissue contain actin and myosin. Muscle contractions and movements are…
Step by step
Solved in 3 steps
- 1. Translation a)Explain the role of ribosomes in the process of protein translation.b. Explain the role of tRNA molecules in protein translation.c. Define the following terms:1. codon 2. anticodon. Explain how a codon is used in the process of translation.8. The following diagram illustrates a step in the process of translation. fMet Pro mRNA UAC GGG AUGCCCACG UAG a) Identify the following elements on the diagram. Aminoacyl site (A) Peptidyl site (P) Exit site (E) Amino end of the newly synthesized polypeptide chain Carboxyl end of the newly synthesized polypeptide chain Approximate location of the next peptide bond that will be formed25. A portion of an mRNA attached to a ribosome reads: 5′ GACAUGAACAGC 3′ If a tRNA with a methionine amino acid attached is in the P site of the ribosome, a tRNA with which amino acid attached will enter the A site? Group of answer choices 1. Asparagine 2. Lysine 3. Threonine 4. Glutamic Acid
- 3b) In the real world, where "wobble" pairing is possible, what is the minimum number of tRNAs required to service all of the threonine codons? Write out the base sequences of the anticodons of those tRNAs (remember to label the 5' and 3' end of each anticodon sequence).28. a. Can a tRNA exist that has the anticodon sequence 5' IAA? If so, which amino acid would it carry? b. Answer the same question for the anticodon sequence 5' xm5s²UAA.c) A gene in a bacteria has the following DNA sequences (the promoter sequence is positioned to the left but is not shown): 5'-CAATCATGGAATGCCATGCTTCATATGAATAGTTGACAT-3' 3'-GTTAGTACCT TACGGTACGAAGTATACTTATCAACTGTA-5' i) By referring to the codon table below, write the corresponding mRNA transcript and polypeptide translated from this DNA strand. 2 Second letter с A UUUPhe UAU Tyr UAC. UGU UGCJ UCU) UCC UCA UUG Leu UCG Cys UUC UUA Ser UAA Stop UGA Stop A UAG Stop UGG Trp G CUU CÚC CCU ССС CAU CGU His САC Pro CC CỦA Leu ССА CAA Arg CGA CUG J CCG) CAG Gin CGG AUU ACU AAU Asn AGU Ser AUC le АСC АCА AAC AAA AGC. Thr JArg AUA AGA AUG Met ACG AAG Lys AGG. GAU Asp GUU) GCU GCC GCA GCG GGU" GGC GGA GGG GUC Val GUA GAC Ala Gly GAA Glu GAGJ GUG ii) If the nucleotide indicated by the highlighted bold letter undergoes a mutation that resulted in deletion of the C:G base pair, what will be the resulting amino acid sequence following transcription and translation? Third letter DUAG DUAG DUAG A. First…
- 2a) Suppose you have a gene in which a single base substitution has created the nonsense mutation 5'TAA3' (which will be transcribed into 5'UAA3' in the mRNA - but recall that mutations are changes in the DNA sequence). Name all the amino acids that could have been coded for by the original, unmutated codon at that position in the gene.1. A portion of the template strand of a DNA molecule that codes for the 5'-end of an mRNA has the following nucleotide sequence. Give the primary structure of the polypeptide (use 3-letter amino acid codes), beginning with the most common translation initiation codon, that will be specified by this portion of the gene. Be sure to label the ends of the polypeptide. 3'-TTTTACGGGAATTAGAGTCGCAGGATG-5'16. Consider the following original coding sequence of a gene that codes for a short 3-amino acid polypeptide: 5'-ATGTGGTCATGA-3' Using the genetic code and the amino acid table below, which of the following sequences arises from a non-conservative missense mutation in the original sequence shown above? First base in codon U C A G UUU UUC- UUA UUG- H₂N+ H H₂N-C- Phe (F) CUU- CCU CUC CCC CUA CCA CUG- CCG AUU ACU AUC Ile (1) ACC AUA ACA AUG Met (M) start ACG- GUU GCU GUC GCC GUA GCA GUG- GCG Nonpolar side chains; hydrophobic Leu (L) U Side chain (R group) OH CH₂ Leu (L) H₂N-C Val (V) HO Glycine (Gly or G) CH3 S CH₂ CH₂ Polar side chains; hydrophilic H O Methionine (Met or M) 0 H₂N-C Second base in codon UCU UCC UCA UCG OH CH, CH HO Aspartic acid (Asp or D) HO Alanine (Ala or A) 0 H O Serine (Ser or S) HO Threonine (Thr or T) Electrically charged side chains; hydrophilic CH3 H₂N-C-C-0- Acidic (negatively charged) CH₂ H₂N+ C CH₂ CH₂ H₂N-C-C-0- H₂N-C- C CH₂ Ser (S) Pro (P) Thr (T) H O…
- 16. Consider the following original coding sequence of a gene that codes for a short 3-amino acid polypeptide: 5'-ATGTGGTCATGA-3' Using the genetic code and the amino acid table below, which of the following sequences arises from a non-conservative missense mutation in the original sequence shown above? First base in codon U A UUU UUC- UUA UUG- CUU CUC CUA CUG- AUU- ACU AUC Ile (1) ACC AUA- ACA AUG Met (M) start ACG GUU GCU GUC GCC GUA GCA GUG- GCG H₂N- U Phe (F) Leu (L) Leu (L) Nonpolar side chains; hydrophobic Val (V) Side chain (R group) H H₂N-C-C-0- HO Glycine (Gly or G) CH₂ H₂N*- CH₂ CH₂ H O Methionine (Met or M) Polar side chains; hydrophilic 0 CH₂ Second base in codon H O Aspartic acid (Asp or D) UCU UCC UCA UCG CCU CCC CCA CCG Alanine (Ala or A) OH CH₂ H₂N-C C 0 H₂N-C C 0 H O Serine (Ser or S) H O Threonine (Thr or T) Electrically charged side chains; hydrophilic OH CH3 CH -0- H₂N+- Acidic (negatively charged) CH₂ H₂N-C-C-O HO C Ser (S) Pro (P) CH₂ CH₂ Thr (T) CH₂ H₂N-C Ala (A)…20. TRNA stands for transfer RNA, since a tRNA molecule transfers an amino acid to the growing protein molecule. You could also think of tRNA as translation RNA. Explain how tRNA molecules help the ribosome to translate the sequence.of nucleotides in mRNA to i sequence of amino acids in a protein. To see the process of translation in action, watch "Translation" at https://www.biointeractive.org/classroom-resources/translation-basic-detail. 21a. Fill in the blanks to label each type of molecule in this figure. a.tRNA $ & 7 8 9.28. a. Can a tRNA exist that has the anticodon sequence 5' IAA? If so, which amino acid would it carry? b. Answer the same question for the anticodon sequence 5' xm³s²UAA. 29. For parts (a) and (b) of Problem 28, consider the DNA sequences of the genes encoding the tRNAs. (Assume both tRNAs exist even if that is not true.) What is the sequence of the RNA-like strand of each tRNA gene that corresponds to the tRNA's anticodon? What is the sequence of the template strand of each gene for these same three nucleotides? Be sure to indicate polarities.