4. Is there any situation in which DNA is made based on a RNA template? If there is, explain with an example how it occurs and state the enzyme involved?
Q: 3. An alteration of genetic information is shown below. A-G-T-A-C-C-G-A-T → A-G-T-G-A-T What type of…
A: Alteration of genetic information shown below is an example of Deletion Mutation. In the given…
Q: 2. If one strand of a DNA molecule has the base sequence5′-AGCATTAAGCT-3′, what is the base sequence…
A: The deoxyribonucleic acid (DNA) is a hereditary material that is found in almost all living…
Q: 3. Imagine that the double-stranded DNA molecule shown was broken at the sites indicated by spaces…
A: In given sequence , broken Strands of double stranded DNA was indicated by spaces. Hence , broken…
Q: 1. What are the differences between DNA and RNA? 2. Which process involves copying of DNA…
A: Note :- Since you have asked multiple questions im only answering the ist 3 as per bartleby…
Q: 5'- What will be the Sanger products of the DNA with base sequence ACGTCGACTCCGGTC-3'
A: DNA sequencing is the biochemical method used for determining the order of nucleotide bases, A, G,…
Q: 1. What is the concept of universality of the genetic code? What are the exceptions to this…
A: Introduction The sequence of nucleotides on m-RNA that code for an amino acid is known as genetic…
Q: 4) Consider the following double-stranded DNA molecule: Complementary Strand: ATGTGTAGTGCGAGTTGA…
A:
Q: what is The entire complement of DNA sequences in an organism.?
A: Genome
Q: 3. The following segment of DNA is the template strand: 5'-.GACATGGAA.-3' a. What is the sequence of…
A: DNA and RNA are are nucleic acids present in the organisms. DNA is the deoxy ribose nucleic acid…
Q: 1. Which of the following rules apply to the synthesis of nucleic acids? A. Nucleotides are added to…
A: Note : Hi ! Thank you for the question. We are authorized to answer one question at a time. Since…
Q: 4. Is there any situation in which DNA is made based on a RNA template? If there is, explain with an…
A: Note: We will answer the first question since the exact one was not specified. Please submit a new…
Q: 1. What is the complementary strand of sequenced DNA? 2. What is the transcription product of this…
A: Here, template stand is given having direction 3'→5' new complementary strand synthesized in 5'→3'…
Q: 6. Write a brief paragraph each to explain what an insertion sequence and a transposon are. 7. What…
A: 1. Inclusion arrangements (Insertion sequences) (ISs) are little bits of DNA which move inside or…
Q: 1) A molecular biologist creates a form of RNA polymerase that has the same proofreading ability as…
A: A polymerase is an enzyme that helps to synthesizes long chains of polymers or nucleic acids. It…
Q: 7. Explain the principle of quality determination of DNA.
A: *NOTE: Kindly repost for other questions. Dear Student as per the guidelines we are supposed to…
Q: 1. During the replication of a DNA molecule, separation or "unzipping" of the DNA molecule will…
A: DNA, is generally a give a short term for deoxyribonucleic acid, is the molecule which contains the…
Q: 1)explain why it is far less important for RNA Polymerase to have proofreading activity than it is…
A: Fidelity of replication is the most important for the very existence of an organism. Besides its…
Q: 1. A certain mRNA codon is determined to be AUG. a. What is the tRNA anticodon? b. What is the DNA…
A: Transcription is the transfer of genetic information from sequence of DNA to RNA, Transcription…
Q: 1. In the Central Dogma, what process involves the production of a new DNA strand using an old DNA…
A: Since you have asked multipart questions on the same topic, we will solve the first three questions…
Q: 1. In the DNA sequence, the bottom strand is a template strand. If the base pair G-C (in bold) is…
A: Transcription is a process which involves formation of RNA molecules from DNA. One of the DNA strand…
Q: 3. Consider the following diagrams representing three different DNA molecules. (a) 5' w 3' 3' 5' (b)…
A: DNA polymerase is an enzyme that catalyzes the synthesis of DNA from nucleotide…
Q: 2. The organization of DNA requires that replication be performed by a large “machine of proteins."…
A: Deoxyribonucleic acid (DNA) stores the cell’s genetic information and is present in the nucleus of…
Q: 6) The diagram shows a strand of DNA matched to a strand of messenger RNA. MRNA is being made from…
A: Francis crick proposed central dogma which gives the flow of genetic information from DNA to RNA to…
Q: 7. An original strand of DNA has the following sequence of nucleotides: NNNNONNNNNNINN CC AT CTGGA…
A: DNA (deoxyribonucleic acid) and RNA (ribonucleic acid) are polymeric molecules essential in various…
Q:
A: Purines is equal to pyrimidines. So A=T C=G
Q: 1. What is the first codon in the mRNA strand? 2. The second codon in the DNA double helix is TAT…
A: The DNA (deoxyribonucleic acid) that forms the genetic material of an individual contains…
Q: 4, Describe the process of DNA replication. In your description, include the terms polymerase,…
A: DNA is a double-stranded molecule that is composed of deoxyribose sugar, a phosphate, and a…
Q: If a different point mutation changed the DNA code from ACG to ACT, would that cause a problem with…
A: Normal DNA contains a particular sequence of DNA. If the sequence of DNA is changed due to external…
Q: 4) Replication of a circular DNA molecule can occur by either theta replication or by rolling circle…
A: Circular DNA - Circular DNA is a kind of DNA that is in the form of loop. Circular DNA has no free…
Q: 1. What is the production of RNA called and what is the enzyme that catalyzes the process?
A: Apologies. We only answer one question at a time. We will answer the first one as the exact one…
Q: 3. The principle theme in biology is DNA transcribes to RNA and RNA translates to proteins. Place…
A: Introduction: The process of copying the genetic information from one strand of the DNA into RNA is…
Q: 1
A: INTRODUCTION:- A mutation is any change in the nucleotide sequence of DNA.Some mutations affect…
Q: 1. For each of the processes below, fill in blanks with one or more of the items in the following…
A: “Since you have asked multiple questions, we will solve the first question for you. If you want any…
Q: Compare the structure and functions of DNA nad RNA.
A: Nucleic acids DNA RNA DNA : Deoxyribonucleic acid : It is long chain polymer of two…
Q: 1. A space probe returns from Jupiter and brings a new microorganism for study. It has a…
A: As we already know that in double stranded DNA replication is semi-conservative and discontinuous…
Q: 4. How is replication different from transcription in terms of product? 5. What do you call each…
A: DNA is the deoxyribonucleic acid which contains the genetic coding of an individual.
Q: What is the main difference in the behavior of DNA and RNA polymerases?
A: Both DNA polymerases and RNA polymerases are enzymes.DNA polymerases are mainly involved during the…
Q: C A T A C G C G T A с G
A: The given figure shows the process of DNA replication. DNA replication refers to the process of…
Q: 1. Determine the effect of the following mutations on the DNA sequence. In each case, the mutation…
A: Any detectable, inheritable, qualitative or quantitative change in genetic material of an organism…
Q: List the DNA strand sequence complementary to the template strand.…
A: DNA contains Adenine thymine, cytosine, and Guanine. Whereas in RNA the Thymine is replaced by…
Q: 4. Discuss and detail reasons why eukaryotic organisms appear to have more DNA than is necessary to…
A: The coding sequences of Eukaryotic DNA is called exon and the non coding sequence of Eukaryotic DNA…
Q: 3. The data in the following table represent the base composition of two double stranded DNA sources…
A: Ervin Chargaff discovered the Base proportion in double stranded DNA. The findings in his study came…
Q: 7. Given what is known about DNA structure, which of the following general shapes might be found?…
A: DNA is the helical structure of two antiparallel polynucleotide. Both the polynucleotides are…
Q: Why is that DNA polymerase and RNA polymerase can synthesize polynucleotides only from 5' to 3' to…
A: DNA polymerase is the enzyme required for replication of DNA and RNA polymerase is the enzyme…
Q: 1. Give the different hydrolytic products of : a DNA b. RNA 2. Enumerate the biological functions of…
A: The biological macromolecules that constitute a living system are : Nucleic acid (DNA and RNA),…
Q: 4. A mutation changes a nonsense codon to an amino acid sequence. Write an example of such a…
A: Mutation is any change in the sequence of DNA that causes a change in the protein that is…
Q: 1. A portion of the template strand of a DNA molecule that codes for the 5'-end of an mRNA has the…
A:
Gene Interactions
When the expression of a single trait is influenced by two or more different non-allelic genes, it is termed as genetic interaction. According to Mendel's law of inheritance, each gene functions in its own way and does not depend on the function of another gene, i.e., a single gene controls each of seven characteristics considered, but the complex contribution of many different genes determine many traits of an organism.
Gene Expression
Gene expression is a process by which the instructions present in deoxyribonucleic acid (DNA) are converted into useful molecules such as proteins, and functional messenger ribonucleic (mRNA) molecules in the case of non-protein-coding genes.
Step by step
Solved in 2 steps with 1 images
- 1. Determine the effect of the following mutations on the DNA sequence. In each case, the mutation is described after the sequence (REFER TO THE SUPPLEMENTAL DOCUMENT FOR GUIDANCE TO THIS QUESTION). Adenine nucleotide (A shown in red below) was inserted into the DNA sequence at the position indicated by the arrow). Write out the sequence of the mutated DNA and the protein made from it. What is the effect of this mutation on the protein? (For example, how will the mutation affect the length and sequence of the protein? What about the function of the protein?) A 3' TACATGG'TTGTGCTAATT 5'1. The image shown in Figure 1 below represents a strand of DNA following replication. The black lines present above the top and below bottom strands of DNA represent the phosphodiester backbone of the molecule. Examine the DNA strands and locate any sites that are damaged, mismatched, or otherwise require repair. Indicate where in the strand the specific lesion is located, and provide a detailed overview of the post-replicative repair process that would likely be used to rectify the lesion. Assume that each lesion, even those that are located in close proximity will be repaired separately. CH, CH, OCH, CH, OCH₂CH, GATCCGAATCGGCTAGGATCGGCATCCGATTCGATCGGCATCCGATCGCTAGCO CH, CH, CH, CH, CH, TACGATCGATC CTAGGATTA CCGACCCTAGCCGTAGGGTAACGTAGCCGTAGGCTAGCGACCGGGGATGCTAGCTAG Figure 1: Graphical Representation of a strand of dsDNA containing errors and damage following replication1. Considering the following nucleotide sequence in an mRNA molecule: 5’ AUG UUA CGU AAU GCU GUC GAA UCU AUU UGC UUU ACA UAA 3' a) Write the sequence of the DNA template (antisense) strand from which the mRNA was synthesized. b) Write the sequence of the DNA coding (sense or informational) strand complementary to the template strand. c) Write the sequence of tRNA anticodon that corresponds to the given mRNA molecule. d) Write the amino acid sequence of the peptide synthesized from the given mRNA nucleotide sequence. e) Draw the structure of the pertide fragment made up of the first five (5) amino acids in the given polypeptide.
- 1). The sequence of mRNA made using the DNA double helix shown below is 2). The sequence of protein made using the mRNA is4) Consider the following double-stranded DNA molecule: Complementary Strand: ATGTGTAGTGCGAGTTGA Template Strand: TACACATCACGCTCAACT a) What would be the amino acid sequence coded for by the template strand of the DNA molecule above?Give the name of the enzyme that catalyzes each of the following reactions:(a) Makes a DNA strand from a DNA template. (b) Makes a DNA strand from an RNA template. (c) Makes an RNA strand from a DNA template
- 1. In a sample solution given for analysis; CATAGCTTTGTTAAA (DNA nucleotide chain). a) Show the 5 'and 3' ends by writing in triplet (codon) form. Find the number of Hydrogen bonds in the double helix DNA strand at the beginning. b) Find the peptide sequence that this DNA chain will synthesize and show the energy balance required for its synthesis and indicate its total load at physiological pH. c) How do you prove that this peptide sequence is as above? Explain.1. Using the gel picture of the DNA ladder, show where your digestion of the paper cutting model showing cut fragments would appear. The linear uncut DNA is 640 base pairs in length. Insert an image below.1. What are the differences between DNA and RNA? 2. Which process involves copying of DNA information from template strand and produces mRNA strand that will be used for protein synthesis? 3. Based on the activity, what is the function of anticodon(TRNA) on protein synthesis? 4. What causes mutation? Is it always harmful? 5. Does a simple change on DNA sequence affect the resulting protein? Explain briefly.
- II. A double-stranded DNA molecule with the sequence shown below can produce a polypeptide that is four amino acids long. Identify which DNA strands are the coding and the transcribed template strands by circling C or T to the left of the table below, respectively. Use an arrow to indicate the direction of transcription. In the table, show the mRNA sequences and amino acids in this peptide. In spaces to the left and right of the table, label all 5' and 3' ends of all relevant nucleic acid strands. READ CAREFULLY: The table gives you the possibility of filling in answers that show transcription from either strand or in either direction. You are only required to fill in the information relevant to ONE PEPTIDE (no others). Refer to the genetic code on the following page. HINT: While we read and write in 2D from left to right, in the 3D world of a cell there is no such restriction on reading and writing associated with transcription or translation. AA mRNA TCA CGG AAT TTC TAG CAT GTA C or…1. A region of DNA in a particular cell synthesizes a segment of RNA that is 174 bases long and in the form of a large palindrome. The RNA is transported to the cytoplasm and folds into a hairpin loop of double stranded RNA. In the cytoplasm, the hairpin loop is recognized by a double-stranded RNA cutting enzyme (dicer) and is cut into 21 BP lengths. When these 21 BP double stranded segments are combined with protein, they function by: Answer choices destroying specific mRNAs priming the synthesis of DNA sequences adding DNA to the chromosome ends (telomeres) acting as decoys for RNA degrading enzymes thus protecting the mRNAs present splicing the introns out of messenger RNA 2. The following are genotypes of merozygotes of E. coli with various combinations of lac operon mutations. Determine the phenotype with respect to beta-galactosidase (z), permease (y), and trans-acetylase (a) of each combination as U = uninducible, I = inducible, and C = constitutive. Choose from…1. Regarding the triple DNA code, which of the following statements is true? • each DNA base encodes three amino acids • there are three genes encoding a protein • each amino acid is encoded by three DNA •bases each triplet encodes several amino acids