5 For the peptide structure in #3, (ASP-ALA-THR-LYS-GLY), use the chart at the end of this HW set to: A. Determine the net charge of the pentapeptide at pH 3, 4, 7, 10 and 11. B. Estimate the isoelectric point, pl, for this 5-amino acid peptide
Q: E. coli replication on the lagging strand O is carried out by DNA polymerase I O is initially…
A: In E. coli genetic information is stored in form of DNA. E. coli DNA is circular in shape. DNA…
Q: 1. Answer the following questions: a. A substance produced from pyruvate that is a precursor in the…
A: Glucose is the simplest carbohydrate, which is utilized as the primary source of energy. The complex…
Q: Why two strands of DNA are not identical but are complimentary to each other?
A: Introduction DNA acts as genetic material in our body. DNA consists of nitrogenous bases, pentose…
Q: Question 1 Signal sequences direct their delivery to different locations in the cell or outside the…
A: The proteins are made of twenty naturally occurring amino acids that are linked via peptide…
Q: Scope of Industrial biochemistry
A: Industrial biochemistry: The practice or application of set of chemical processes that occur within…
Q: Question 22 Each GroEL subunit has an ATP-binding pocket that catalyzes hydrolysis of its bound ATP…
A: GroEL-ES is a molecular chaperone complex assit in folding of cellular proteins. GroEL is composed…
Q: What product is formed in the committed step of the biosynthesis of pyrimidines? O a. pyrophosphate…
A: Pyrimidine biosynthesis happens in the cytoplasm with six steps process and it is synthesized from a…
Q: O2 is a competitive inhibitor of the hydrogenase enzyme that catalyzes the conversion between…
A: A competitive inhibitor is a type of inhibition in which a inhibitor, binds to the active site of…
Q: The following assays is/are considered a DIRECT ASSAY: A. absorbance B. рн C. Viscosity D. All of…
A: Process of analyzing a substance to determine its composition or quality is an assay. In medicine,…
Q: 3. Prostaglandins (5) are derived from the 20-carbon fatty acid arachidonic acid in a reaction…
A: In order to solve this problem , we need to draw the Lineweaver Burk plot (LB plot). LB plot has…
Q: Arrange the steps in the reaction catalyzed by threonine dehydrates in order, using the racemization…
A: Threonine dehydratase catalyzes the conversion of threonine to α-ketobutyrate , H2O and NH3 . The…
Q: ATP + H₂0 ➜ ADP + Pi 3Na+ (inside) + 2K+ (outside) AG = -30.5kJ/mol + ATP4 + H₂O → 3Na* (outside) +…
A: Gibbs's free energy, known as free energy or G, is a thermodynamic quantity that represents the…
Q: In a folded protein, Glu116 is close in three-dimensional space to Lys224. The pKa of the carboxylic…
A: pKa is the pH at which a weak acid is 50% dissociated. Alternatively, pKa = -log Ka. In acid-base…
Q: During the metabolism of glucose in anaerobic cells, the enzyme lactate dehydrogenase is essential…
A: Lactate dehydrogenase catalyzes the interconversion of pyruvate and lactate. The enzyme is an…
Q: The B-oxidation of the saturated 14-carbon fatty acid myristic acid yields the following NET amount…
A: In beta oxidation, large fatty acids that have been transformed into acyl-CoA chains are gradually…
Q: Which of the following tripeptides has a net charge of +1 at pH 8? O SIT OPEN OAKT DIG OWTG
A: Peptides are made up of amino acids. Every amino acid have an alpha-carbon that is bonded to 4…
Q: Bile acids: localization of synthesis, their biochemical significance.
A: Introduction Cholesterol is a compound which is essential for our body. Cholesterol is synthesised…
Q: Enzymes increase the rate of a reaction by which contributing factor? - Increasing Keq -Formation…
A: Enzymes as biocatalysts catalyse the biochemical reactions by decreasing the activation energy so…
Q: In prokaryotic RNA synthesis the rate of incorporation of nucleotides is constant throughout the…
A: In prokaryotes, RNA synthesis is carried out the enzyme RNA Polymerase. RNA Polymerase read the DNA…
Q: What is the concentration of the cough suppressant in parts per million?
A: Some solutes might be present in a solution in very little amount. So, the concentration of these…
Q: Long chains of beta glucose monomers are held together in microfibril bundles by bonds Vanderwaals…
A: Carbohydrates or carbs are maconutrient consisting of Carbon, hydrogen and oxygen atoms. In nature…
Q: how does high pressure O2 treat CO poisoning?
A: Hemoglobin is a globular protein, ie it is roughly spherical. It is a tetramer of two types of…
Q: Eukaryotic RNA polymerase II resembles the prokaryotic RNA polymerase core. Which of the following…
A: Prokaryotes have only one RNA polymerase called prokaryotic RNA polymerase, but eukaryotes have…
Q: 5. Ways of cholesterol biotransformation, their tissue localization: 5.1. extracellular (LCAT) and…
A: Sterols are lipids with the characteristic steroid nucleus. The steroid nucleus is four fused rings,…
Q: True of false 6. In glycogen synthesis, the active form of glucose is UDPG. () 7. If people lack…
A: Glycogenesis : It is the process of synthesis of glycogen from glucose. Glycogen is a polymer of…
Q: Draw the L(leucine)-A(alanine)-E(glutamate) triple tide and calculate its isoelectric point.
A: Amino acid sequences are written with N-terminal amino acid on the left and C-terminal amino acid on…
Q: The hormones insulin and glucagon play an important role in the regulation of plasma glucose. a)…
A: Our body primarily uses glucose as a source of energy. In order to carry out the normal functions of…
Q: Write a scheme for the synthesis of mevalonic acid as the first stage of cholesterol synthesis.…
A: Cholesterol is a sterol found in the plasma membrane that has the characteristic steroid nucleus (4…
Q: Based on your knowledge of the natural amino acids, what would you expect pKa of the side chain of…
A: Succinic acid have 4 carbons, among which the two terminal carbons are carboxylic acid groups. The…
Q: 1. Calculate a creatinine clearance and its reference range. 2. Explain the biochemical formation…
A: Since you have posted multiple questions, we will provide the solution only to the first question as…
Q: Calculate length of tubes required for desired production rate
A: Proteins Proteins are the long chain of amino acids , they are essential for the structure,…
Q: 5. Explain in quantitative terms the circumstances under which the following reaction can proceed in…
A: Positive delta G means that the reaction cannot occur spontaneously. If delta G is negative then it…
Q: Compared to an uncatalyzed reaction, an enzyme-catalyzed reaction ________. A) uses less substrate…
A: Enzyme kinetics is the study of the rates of chemical processes that are catalyzed by enzymes. The…
Q: 1. Weigh 1 g of isolated polysaccharide sample (sweet potato starch) in a 10 mL beaker using an…
A: A solution is prepared by dissolving a solute into a solvent, and the concentration of solute can be…
Q: The major site(s) of glycogen storage is/are: A) adipose tissue. OB) liver. OC) skeletal muscle. D)…
A: Glycogen is a Polysaccharide made up of glucose residues. It is a branched Polysaccharide and acts…
Q: 21. The structure of D-arabinose is shown below. How many stereoisomers are possible for this…
A: In carbohydrates, the carbon that is attached to four different groups is called a chiral centre.…
Q: Subunit Composition of a Protein. A protein has a molecular mass of 400 kDa when measured by…
A: Size exclusion chromatography is a technique which separates molecules according to their size…
Q: Soy milk is rich in vegetable protein (about 4.5 grams of protein per 100 grams of soy milk) and…
A: INTRODUCTION : Proteins : Proteins are simple & complex biocompounds which are needed by the…
Q: The peptidyl transferase reaction is an exemplification that the ribosome is a ribozyme. True False
A: Enzymes are bio-catalyst that participate in biochemical process and they are highly specific in…
Q: Mutations within this gene CAGATTGTGAAGAGGTCTCTTGA are causative of which human diseases? A.…
A: The nucleotide sequence provided corresponds to the XPA gene of humans. This is deduced by doing a…
Q: how do we name the bond between monomer B and monomer C
A: Chemically carbohydrates are polyhydroxy aldehydes or ketones. They have the general formula :…
Q: At which temperature given does hemoglobin have a higher affinity for oxygen?
A: Hemoglobin is a protein that transports oxygen from lungs to tissues and CO2 from tissues to lungs.…
Q: Given the Lewis structure below: HO H H C C C C CIH There are sigma bonds and pi bonds.
A: Sigma and pi bonds are types of covalent bonds that differ in the overlapping of atomic…
Q: CHOOSE THE ANSWER FROM THE FOLLOWING CHOICES: Phosphodiester Bond Glycosidic Bond Ester…
A: Nucleic acid can be of 2 types: DNA (deoxyribonucleic acid) RNA (ribonucleic acid) Nucleic acids…
Q: Suppose you want to test the results of a transformation by growing E. coli cells in LB medium…
A: Equation of dilution: M1V1 = M2V2where: M1 is the molar concentration of the stock solution. M2 is…
Q: Reabsorption of this substance involves carbonic anhydrase - inulin - bicarbonate - glucose -…
A: Enzymes are biocatalyst that increases the speed of reaction by lowering the activation…
Q: In isolating and characterizing carbohydrates, choose between starch and cellulose from a plant…
A: Carbohydrates are composed of carbon, hydrogen and oxygen (CH2O) which performs several functions in…
Q: What is the correct order, from highest content to lowest content, for triacylglycerols in the…
A: Lipoproteins are droplets of fats that are surrounded by a single layer of phospholipid molecules.…
Q: 3. β-oxidation of higher fatty acids: 3.1. tissue and intracellular localization of the process…
A: Fatty acids are very important class of macromolecules in our body. The degradation of fatty acid is…
Q: An N-linked glycoprotein contains a glycan covalently linked to which specific amino acid in a…
A: N linked glycosylation is the process in which an oligosaccharide molecules are attached to proteins…
Trending now
This is a popular solution!
Step by step
Solved in 2 steps with 5 images
- Determine the net charge (to the nearest integer) on the following peptide at pH 5 AND pH 12. Estimate the isoelectric point (pl) for this peptide: H2N-Leu-Gly-Lys-Glu-COOH Assume the pK,s for functional groups are: alpha-amino 6. alpha-carboxy sidechain-amino (Lys) 10.5 sidechain-carboxy (Glu) 4.2 O Net charge at pH 5 and 12 is 0 and -2, respectively, pl =6.6 O Net charge at pH 5 and 12 is 0 and -2, respectively, pl =3.1 O Net charge at plH 5 and 12 is +2 and -1, respectively, pl =7.5 O Nct charge at pH 5 and 12 is +1 and -1. respectively,. pl -4.5 2.Given the following Peptide: Q6 *H;N-Phe-Asp-Ala-Arg-Gy-His-Arg-Asp-Glu-His-Tyr-CO 6a. What is the peptide's net charge at pH 2.0, pH 6.0, pH 7.4, and pH 10.2? (show work) 6b. What is the approximate isoelectric point of this peptide?A. Write the structure of the following peptide at pH 5.0 and calculate its net charge at this pH. Asp-His-Tyr-Arg-Lys-Leu-Thr-Gln. Based on the pKa value of the ionizable groups. B. A polypeptide consisting only of L-glutamate residues (poly-L-glutamate) may have a random coil or helical structure depending on pH. Explain this behavior by indicating at what pH values the helical structure will be favored.
- For the peptide Ala-Cys-His-Ile-Leu-Asp a. Write the single letter code for the amino acid residues b. What is the charge of the peptide at pH 7.0. Assign the following pKa values: 3,4,6,8,9 c. What is the pI of the peptidepeptide Lys-Glu-Trp answer the following questions: Draw the structure of this peptide when all the ionizable groups are fully protonated. How many ionizable groups does this peptide have? Label the pKa for each of the ionizable groups in the structure above. Draw the appropriate titration curve for this peptide on graph paper starting at pH 0 and ending at pH 14. Label the x-axis, y-axis and the pKa Determine the overall net charge of this peptide at each full equivalent point (including 0) where the ionizable group is 100% deprotonated. Determine the pI for this peptide. Determine the average overall net charge of a mixture of this peptide in a solution where pH=8.5.For the following pentapeptides: Ser-Glu-Gly-His-Ala and Gly-His-Ala-Glu-Ser A. Compute their isoelectric pH (pI). Show full solution. Use standard pKa values. B. Do these peptides with the same amino acid composition have different net charges at pH 7.0? Explain briefly. C. Would you expect the titration curves of the two peptides to differ? Why or Why not?
- Peptide A: AFEQHSR Calculate the isoelectric point of Peptide A using the pKa values in Table 4-1 of Voet, Voet and Pratt. Assume that the pKa values for the N-terminal amino group and C- terminal carboxyl groups are 8.0 and 3.5, as previously discussed in class. 3.785 5.055 7.02 10.24 3.50Calculate the net charge of the following peptide at pH 2, pH 6 and pH 14 (use 2 and 9 as pKa values for the carboxylic acid and amino groups, respectively, use the attached table for the side chain pKa values). Ile-Leu-Ile-Lys-Glu-Cys-His-Glu-Met-Ile-Ser-Thr-Arg-Tyr1. A pentapeptide has the sequence of H2N-Glu-His-Leu-Arg-Gly-COOH. a) What is the net charge of the peptide at pH 3, 8, and 11? (Use pka values for side chains and terminal amino and carboxyl groups in the table provided.) peptide. b) Estimate the pl for this pK, values Abbreviation/ symbol pk, M, (-COOH) (-NH5) (R group) pK; pKR Hydropathy Occurrence in index* proteins (%)* Amino acid pl Nonpolar, aliphatic R groups Glycine Alanine Proline Valine 2.34 -0.4 Gly G Ala A Pro P 75 9.60 5.97 7.2 89 115 2.34 9.69 10.96 6.01 6.48 5.97 1.8 1.6 4.2 3.8 4.5 7.8 5.2 1.99 117 131 Val V 2.32 2.36 9.62 9.60 6.6 9.1 Leucine Leu L 5.98 Isoleucine lle I 131 2.36 2.28 9.68 6.02 5.3 Methionine Met M 149 9.21 5.74 1.9 2.3 Aromatic R groups Phenylalanine Tyrosine Tryptophan 2.8 -1.3 3.9 3.2 Phe F 165 1.83 9.13 9.11 9.39 5.48 2.20 Tyr Y Trp W 181 10.07 5.66 204 2.38 5.89 -0.9 1.4 Polar, uncharged R groups Serine Ser S 105 2.21 6.8 9.15 9.62 5.68 5.87 5.07 5.41 5.65 -0.8 Threonine Thr T 119 2.11 -0.7 5.9…
- a All amino acids have at least two ionizable groups: an a-amino group (average pK₁ of 8.0) and an α-carboxylic acid group (average pK₂ of 3.1). Histidine also has an ionizable side chain (R group) with a pKa of about 6.0. One of the possible ionization states of histidine is shown in a the image. Select the pH values at which the charged form of the R group would predominate. 6.0 At what pH would the structure shown be the predominant ionization state? Consider the ionization state of all three of the functional groups. 2.2 + The protonated form of the R group of histidine is shown in the structure. The ratio of the charged (protonated) form to the deprotonated form depends on the pK₁ of the R group and the pH of the solution. 4.9 H₂N-CH-C-OH | CH₂ 11.5 + HN -NHDetermine the pI of the peptide H2N-Ala-Lys-Ser-Arg-COOH at pH 11, please explain why some pKas are used in the solution of the problem while others are not.Given the following peptides below, what would be more soluble at the indicated pH? 1. (Gly)20 or (Glu)20 in pH 7.0 2. (Lys-Ala)3 or (Phe-Met)3 in pH 7.0 3. (Gly)20 or (Glu)20 in pH 6.0|| 4. (Ala-Ser-Gly)s or (Asn-Ser-His)s in pH 6.0 5. (Ala-Asp-Gly)8 or (Asn-Ser-His)8 in pH 3.0