5. Tell how the stroke volume and heart rate will be effected based on the following scenarios. upward arrows for increase and downward arrows for decrease. Think of these scenarios as IMMEDIATE responses (within seconds). Scenario Stroke volume Sympathetic neurons activated: Stronger myocardium contraction: Very weak myocardium contraction: Back-pressure / resistance from major arteries: Parasympathetic neurons activated: Exercise: Dramatic lack of blood in venous-return: Dramatic increase of blood in venous-return: Excited or scared: Heart rate Scenario Sympathetic neurons activated: Parasympathetic neurons activated: Exercise: Excited or scared: SA Node increases Action Potential: SA Node decreases Action Potential:

Q: Describe for each of the following drugs / drug substances the factors that make absorption and meta...

A: A drug is any substance that causes a change in an organism's physiology or psychology when expended...

Q: Anyone know these three Blood. Cells?

A: White blood cells (leukocytes) don't have a well-defined shape because their shape is continually ch...

Q: For a given radius, r, which has the lowest resistance per unit length?   A. Four arteries with ...

A: There are three fundamental components that specify the resistance to blood flow within a solitary v...

Q: List the chemical composition of urine.

A: Urine is a fluid by-product of metabolism in humans and in various  animals. Urine being excreted fr...

Q: An example of a positive feedback mechanism is blood clotting in which certain clotting factors acti...

A: The ability of an organism by which it is capable of maintaining its environment in a steady and sta...

Q: **Kindly justify your answers with cited references.

A: The type of physical trauma that is caused to the body by an external force is referred to as injury...

Q: Compare the "Lock and key "model with the "induced fit" model of enzymes

A: The proteins which act as catalyst in the biological reactions are known as enzymes. They attaches t...

Q: What are Cranial and spinal nerves ?

A: Cranial nerves can be defined as nerves that originate from the brain and spinal nerves are referred...

Q: It is the Body condition that should be met prior to the collection of arterial blood sample?

A: An arterial blood sample is collected from an artery, primarily to determine arterial blood gases. A...

Q: Please answer this question. I mainly want part A, but if you could answer part B as well, I would r...

A: Transcription is the process of formation of mRNA from DNA molecule.  Translation is the process of ...

Q: Bacteriophages are viruses that infect bacteria. Depending on the bacteriophage, their genome can be...

A: BACTERIOPHAGES : a bacteriophage is also known as a phage , is a virus that infects and replicates w...

Q: Computer Engineering Assignment: 2} Write a C Program to Calculate Area of Circle using Pointer

A: In this program, we pass a pointer address to a float variable. It holds the address of that particu...

Q: Palpate as many of the following structures as possible, and identify which ones cannot normally be ...

A: Palpation is a technique for feeling with the fingers or hands during an actual assessment. The medi...

Q: How is the eyeball connected to held in the skull?

A: The human eye is considered as one of the significant sense organ and an important part of the visua...

Q: A small section of Saccharomyces cerevisiae gene has the amino acid sequence valine, histidine, cyst...

A: Proteins are polymers of amino acids. The synthesis of amino acids is governed by the sequences of b...

Q: Explain the formula for calculating the glomerular filtration rate.

A: Kidneys are vital organs responsible for blood filtration. They are bean-like structures in shape an...

Q: Some Events Occur in a Cell During Translation   mRNA binds to a ribosome. Transcription completes....

A: Translation is a process which means Protein synthesis And prior to this Transcription completes in ...

Q: * Cardiac muscle 1. Where are intercalated discs located?What is their function? 2. Describe two mor...

A: Muscle is considered to be the specialized tissue originating from the mesodermal region. It contrib...

Q: Several different nucleic acids are involved in the process of getting a protein produced from a gen...

A: 1a. The template DNA strand, from which the mRNA is synthesized, is 5’ CAAACTACCCTGGGTTGCCAT 3’ (RNA...

Q: Develop an understanding of basic principles ofpharmacology, including mechanisms of drugaction, adv...

A: The study of medications and their actions on all life forms or living organisms is called pharmacol...

Q: How do the responses to skin sensations differ between the somatosensory cortex and the insular cort...

A: The somatosensory system is a part of central nervous system and is a complex of sensory neurons and...

Q: The lung was the first air breathing organ (ABO) that evolved in ancient fishes, but after fish evol...

A: "Since you have asked multiple questions, we've solved the first question and its sub-parts for you....

Q: What dose the vestibule of the ear do?

A: The vertebrate has two ears. Each is located on either side of the face. Each ear is divided into th...

Q: An EKG of Ventricular Fibrillation shows:     A. A highly disordered sequence.   B. A QRS co...

A: Heart is defined as a muscular organ that is present behind and slightly left to the breast bone. Th...

Q: Why do obstructive disorders not affect breathing rate? Recall the mechanism for inspiration

A: The respiratory system (also known as the respiratory apparatus or ventilatory system) is a biologic...

Q: Mitochondrial DNA (mtDNA) is genetically identical to Select one: a. DNA found in the nucleus of t...

A: Different nuclear DNA, which is inherited from both parents and in which genes are altered in the pr...

Q: Describe the normal anatomy (structure) and physiology (function) of the respiratory system and the ...

A: Respiratory system is one of the essential systems of the body necessary for survival. It facilitate...

Q: The following is incorrect about directions of impulses in the neurons Select one: a. Sensory or aff...

A: The neurons or nerve cells have a special ability to get excited via action potential.  The cell-to-...

Q: Discuss in detail the steps for the synthesis of the major metabolic hormone in the human body.

A: The endocrine system is an integral body organ system that concerns the production, synthesis, regul...

Q: Chose two of the major muscles or muscle groups. Using correct terminology and with reference to ins...

A: There are more than 600 muscles in our body which helps in the movement of body. 

Q: Describe three ways in which the dermis differs from theepidermis.

A: The skin covers the body completely and thus is regarded as the largest organ. It forms the first li...

Q: Quiz: 1} What is the name of the large, long bone found in the upper leg? 2} What is the name of the...

A: 1) The skeletal structure of the body is composed of bones, joints and cartilages. Bones are primari...

Q: **Kindly justify your answers with cited references.

A: Muscles are smooth tissues that are composed of contractile proteins, actin and myosin. These protei...

Q: Briefly differentiate between the processes and steps involved during the formation of dilute and co...

A: Animals accumulate ammonia, urea, uric acid, carbon dioxide, water, and ions like Na+, K+, Cl-, phos...

Q: Hi, Descending pathway that inhibit pain stimulates inhibitory interneueons in the spinal cord. True...

A: Pain is a major health issue that declines the quality of life. The nervous system plays an importan...

Q: If the dumbbell during a bicep curl is held at 90 degrees of elbow flexion, the elbow flexors are: O...

A: A bicep curl refers to a strength training exercise that focuses on the upper arm, specifically the ...

Q: 8

A: Cancer is a disease in which there occurs abnormal growth of the cells of body and they starts to sp...

Q: Describe the effect if the atria were to contract at thesame time as the ventricles, or if the ventr...

A: The cardiovascular system is an organ system which distributes blood to all the parts of the body wi...

Q: What is the artery that provides collateral circulation to the hand when the radial artery become th...

A: The region of the upper extremities that lies at the terminal region and begins after the wrist is d...

Q: Describe how Charles Sherrington used behavioral observations to infer the major properties of synap...

A: A small gap presents between the two nerve cells which are responsible for the transmission of signa...

Q: Trace the journey of a drop of blood starting from the right atrium, continuing to the right thumb, ...

A: The cardiovascular system is a vital division of the body's circulatory system that concerns the tra...

Q: Structure B represents-

A: The cell forms the basic unit of life. New cells come into being only by the division of pre-existin...

Q: Daniel is a 52-year-old male with a history of obesity and diabetes. He had gastric bypass surgery 6...

A: Introduction: Kidney stones also referred to as renal calculi, are hard deposits of acid salts and m...

Q: (Following Question 25) If a mutation occurred such that A2 allele appeared in this population. The ...

A: Natural selection is an evolutionary mechanism that tends to select the phenotype of an organism. It...

Q: Describe how the endocrine system and renal system integrate to restore homeostasis in an individual...

A: The endocrine system is made up of several glands and their hormones. The glands are the organs of t...

Q: Follicle stimulating hormone inhibits the secretion of which hormone in a short loop negative feedba...

A: Hormones are chemical messengers that are released from the endocrine system and are transported in ...

Q: Which process in protein synthesis is most affected by a missense mutation? Select one: a. Replica...

A: In the cells of the human, there are different process occurs. Each process is unique in its functio...

Q: The following is supplied by autonomic nervous system: Select one: a. Glands b. Smooth muscies C. Ca...

A: The human neural system consists of two contrasting functional subsystems- the central nervous syste...

Q: discribe Decrease with cardiac output, arteries stiffening

A: The heart is a muscular organ with the size of a fist that is found in the chest just above and to t...

Q: Explain what dementia is including a definition and the signs and symptoms. Min of 200 words.

A: Cerebrum and Diencephalon form the forebrain. The cerebrum is the major part of the brain and is the...