6. Alleles A and a are present in the parental nucleus, how many are present in the gametes? (This illustrates Mendel's first principle, segregation. The Law of Segregation means that during gamete formation, pairs of alleles are separated (segregated) form each other and end up in different gametes.) 7- What are the genotypes of the gamete nuclei?

Q: what ways to modify food and kcal intakes to achieve beneficial physiological changes

A: Beneficial physiological changes : Physiological changes in day-to-day life and activities that can…

Q: In the cell wall staining experiment of Bacillus megaterium, what color can you find in a) cell…

A: Introduction: In biology, staining is done to draw attention to particular structures so that living…

Q: Describe in detail the connection between neurotransmitters and Parkinson disease. (150 words)

A: Parkinson's disease (PD) is a neurodegenerative ailment that progresses and is characterised by…

Q: Pineal body Arbor vitae lateral ventricle cerebellum 3rd ventricle corpus callosum optic chiasma…

A: It is critical to learn and know the anatomy and physiology of the body. Many changes in the animal…

Q: Transverse groove of the oblique ridge O Distal oblique groove O Buccal developmental groove O…

A: Introduction :  There are 4 types of teeth which are found in humans:  1. Incisors are the teeth…

Q: A tumour inducing plasmid shown in Figure 2 is isolated from a soil bacterium. (i) Auxin Left Border…

A: A plasmid vector must have a single replication origin, a cloning site (where restriction enzymes…

Q: There are plant pigments on the column and use a 10:1 dilution of hexanes to acetone as your mobile…

A: In normal phase chromatography, the mobile phase is non-polar while the stationary phase is polar in…

Q: Which of the following statements is false? a mutation in a 5' or 3' splice site must alter the…

A: When genes occasionally undergo "mutations", which alter the instructions for forming the protein,…

Q: You would like to clone a gene from a thermophilic bacterium isolated from a hot spring. The…

A: Designed protocol for cloning and expression 1. DNA extraction of the thermophilic bacterium using…

Q: Control of blood flow is primarily mediated by

A: Arterioles, small blood vessels that carry blood away from your heart. They control blood flow…

Q: Jackson Wang is a biologist working with the genetics of a thermophilic bacterium. He cloned a heat…

A: Gene cloning is a frequent process in molecular biology labs where researchers make clones of a…

Q: Which of the following polypeptides (written from their N terminal ends) is encoded by the following…

A: The genetic code is a set of instructions that enable live cells to produce proteins using genetic…

Q: Why can more organisms tolerate higher concentrations of sugar than salt? Please explain from both…

A: Introduction:- Organisms habitat that contain an excess of carbohydrates in the form of sugar are…

Q: What is visible illness and invisible illness ?

A: The distinction is made between the terms disease, illness, and sickness. The term disease literally…

Q: If the primers you purchased possessed the following information. Number of Guanine: 5 Number of…

A: Melting temperature of primer depends on AT and GC content and length of primer. There are two…

Q: BHI TTGTAAAACGACGGCCAGTGAGCGCGCGTAATACGACT M13-20 primer binding site Bsp 1061 goi Primer design…

A: It is required to use oligonucleotide primers while conducting a PCR reaction. Designing primers…

Q: Questions A) what is the independent and dependent variable. B) what were the results of the…

A: Using three-dimensional computer animations of chimpanzees either yawning or with relaxed facial…

Q: 25) In most social insects, females (workers and queens) develop from fertilized eggs and are…

A: The conflict of interest between the queen and her worker daughters over the generation of…

Q: Which of the following statements are true about the rate of mutation in tumor cells (select all…

A: Chromosome rearrangements, which occur at high rates due to aneuploidy, an aberrant chromosome…

Q: Which statement below best describes what these data might have demonstrated to Kornberg about the…

A:

Q: Empathy in prairie voles: Is this the consolation prize?

A: Empathy: Empathy is defined as the ability to understand other people's feelings and emotions. Some…

Q: Match each statement with the best possible single answer from the list below. Terms may be used in…

A: Addition of TTGGGG repeats Correct match for this statement are - Telomerase.   Explanation…

Q: Which of the following molecules would you add to skin cells to reduce the chance of skin cancer?…

A: As we know The skin consists of the upper layer epidermis, middle layer dermis, and lower layer…

Q: Explain your results when observations as stated below were obtained after the plasmids were…

A: DNA is a polymer composed of two polynucleotide chains that coil around each other to form a double…

Q: Order:  1 L of 0.9% NS with 40,000 units of heparin over 24 hours.  Calculate the rate in mL/h.

A: Heparin is used to prevent or treat certain blood vessel, heart, and lung conditions. Heparin is…

Q: Instructions: Put the following terms into a word map to explain how they are interrelated for DNA…

A: DNA has the ability to self replicate. It undergoes semi-conservative replication. DNA Replication…

Q: 26. What is the start codon and the corresponding amino acid for which it codes? FIISI DAS U O O UUU…

A: Introduction  The genetic code is a set of instructions that enable live cells to produce proteins…

Q: QUESTION 37 A reservoir is O an environment that may contain various pathogenic microbes. O a living…

A: Introduction :- All living and non-living objects that occur naturally, or in this example, without…

Q: You are part of a group of researchers examining the survivorship and fecundity of Bengal Tigers…

A: Animals are illegally poached all over the world for fun or for their body parts. Over the last…

Q: I need help finding a plan and listing a plan  in chronological order for the top down approach for…

A: Introduction-- outbreak investigation steps Step 1: Prepare for field work. The numbering scheme…

Q: What determines the resolution limit of a microscope? Is the purpose of the fluorescence microscope…

A: Limit of Resolution is the ability of objective lens two clearly separate the two points of the…

Q: Describe the feeding biology of centipedes, spiders, mites and beetles. Compare and contrast these…

A: We know that centipedes, spiders, mites, and beetles belong to the phylum Arthropoda and which is…

Q: How would deletion of the DnaA gene affect the process of DNA replication?

A: Introduction :- A double-stranded DNA molecule is copied to create two identical DNA molecules…

Q: Many invasion process models (including the framework in Blackburn et al. 2011) have emphasized that…

A: Invasion : Biological invasion is a process by which an organism introduced to and establishes a…

Q: Examples of ionizing radiation that are able to damage DNA and kill bacteria are Microwaves and…

A: Bacteria Or microbial pathogens can be killed by gamma ray, Ultraviolet rays, Radiowaves of…

Q: xplain how Protein Data Bank (PDB) can assist Dr.

A: protein data bank it enables science and education by providing access and tools for exploration,…

Q: The following type of tissue is composed of a single layer of cells that looks like many: a. Simple…

A: Columnar epitheliums are of two types based on the presence of cilia. Ciliated columnar cells…

Q: Identify the structures and events of the sliding filament mechanism. A band H zone H zone reduced M…

A: SLIDING FILAMENT THEORY:  Sliding Filament Theory explains the mechanism behind the Contraction and…

Q: What is the major difference in the functions performed by the conventional PCR and real time PCR?…

A: PCR REAL TIME PCR A technique to amplify a segment of DNA , generating millions of copies of a DNA…

Q: The soil bacterium Agrobacterium tumefaciens, also regarded as 'nature's own genetic engineer', is…

A: As per our guidelines, we are supposed to answer only three sub-parts. Kindly repost the question…

Q: 18. The amino acid sequence is matched with three bases on mRNA codon or DNA codon (pick one). 19.…

A: Please follow step 2 for detailed explanation.

Q: You are growing a culture of S. aureus. You know that 9 generations have occurred after 6 hours.…

A: Introduction  Binary fission, a process that causes bacteria to divide into two daughter cells, is…

Q: 2) Concerning the figure below. $. 24 ACC GGGUA - AUG 17 lif UAA A) Which process is being…

A: Translation is the process by which ribosomes in the cytoplasm or endoplasmic reticulum make…

Q: Question 9 Smooth muscle is responsible for vasoconstriction. True False

A: Cells are the basic structural and functional unit of all known organisms which help in the process…

Q: Describe the steps of DNA replication.  (3 sentences please)

A: Introduction: DNA replication is the process of duplicating DNA. Replication is carried out through…

Q: Draw a strict consensus tree based on your tree and Tree 2. Circle all the polytomies.

A: The strict consensus tree is a tree where the included clades are those that are present in all the…

Q: Which of the following would be most likely to have a dramatic effect on the amino acid sequence of…

A: The protein is a sequence of amino acids. The two amino acids are joined by peptide bond.

Q: 5'-GUCAGCAU-3' but i need help understanding why is it.

A: Introduction In the majority of species, genetic information is stored in DNA. Each human cell has…

Q: Besides real time PCR, Shania will also be using other variations of PCR; Multiplex PCR, Reverse…

A: Multiplex PCR used in  temperature-mediated DNA polymerase in a thermal cycler.    Multiplex PCR is…

Q: What would happen if a chromosome didn't have telomeres, or telomerase was faulty?

A: In DNA replication, the DNA unwinds, and the two strands detach at the "replication origins" a…

Inheritance and Mendelian Genetics

Inheritance means the passing of traits to offspring from parents. These traits could be passed either through asexual reproduction or sexual reproduction. The offspring receives the genetic material from the parents. Mendelian inheritance is a certain biological inheritance that follows the rules and principles laid down by Gregor Mendel in 1865. The initial hypothesis was considered wrong, but other inheritance theories modified the concept of inheritance and thus genetics.