6. B cells are most important in the _______ immunity type of _______ immunity.? .A.Cellular; specific B.Cellular; innate C.Humoral; specific D.Humoral; innate.

Q: The size of a DNA fragment that can be inserted into an unmodified λ vector is very limited. Large…

A: One of the earliest biological organisms whose transcriptional regulation was thoroughly…

Q: What is the difference between cost per billable test and cost per reportable result. (Give examples…

A: introduction : Cost per Test is a module for cost accounting. A Cost per Billable Test is generated…

Q: What are the functional differences between on-center ganglion and off-center ganglion cells?

A: Introduction :- The retina's main output cells are ganglion cells. At the optic disc, where their…

Q: How will the CO2 concentration change in the field influence leaf photosynthesis measurements?

A: Metabolic process is a basically chemical reactions in which bigger molecules are formed/ destroyed…

Q: transmission) and ✓transmission, which is transmission through organisms including pesky mosquitoes.…

A: vector is an organism, that do not cause disease itself but it transmits the infection by pathogens…

Q: Considering the anatomy of reptiles and amphibians explain the difference between these two 2…

A: Reptiles and amphibians are the important organisms under the animal kingdom. They are tetrapods…

Q: CRISPR technology is revolutionary and has the potential to transform medicine, enabling us to not…

A: CRISPR is somehow underdeveloped, as in many areas it lacks in precision and efficiency. For humans,…

Q: METAPHASE CELLS: Find and observe a metaphase cell. Sketch or paste it on the right ANAPHASE: Find…

A: Mitosis and meiosis are the two distinct processes of cell division. When  we talk about "cell…

Q: An ophthalmic solution is preserved with 0.0008% (w/v) of an antibacterial. Ex- press this…

A: introduction : One technique to indicate concentration is through ratio strength, which uses a ratio…

Q: Complete the table below by giving a complete description of the following common viral infections…

A: Viral infections are the infections caused by viruses which are made of genetic material inside of a…

Q: During PCR, the reaction mixture cycles through three temperatures (for example 94, 60, and 72…

A: Introduction :  Using the thermo-resistant DNA polymerase, the polymerase chain reaction, also known…

Q: Does increasing amylase production alleviate the symptoms of lactose intolerance? Why or why not?

A: Lactose sugar is present in the milk. So people with lactose intolerance cannot tolerate milk and…

Q: Cloning of a gene from the rubber tree can be carried out in bacterial cells. However, for the…

A: Cloning: It refers to the process of creating multiple identical copies of gene-sized pieces of DNA.…

Q: a) Based on this tree is the chicken, mouse, human, or hamster most closely related to the bat? b)…

A:

Q: What makes transparent softening lotion different from suspension softening lotion? Is it because of…

A: Cosmetics can be differentiated into various sub-categories based on various features, such as:…

Q: Which of the following are found in mammals?   hair mammary glands all of the choices are correct a…

A: Introduction  Mammals are a group of vertebrate animals that make up the class Mammalia. They are…

Q: what are the goup of muscles that is working to allow a hip flexion in a squat?

A: Introduction  Squats are a complex exercise. They therefore engage a number of lower body muscle…

Q: Plz answer this all questions    What muscle in the shark is homologous with the geniohyoideus in…

A: The common mudpuppy is a species of the salamander belongs to the genus Necturus. They live an…

Q: If a genetic female fetus is exposed to testosterone in utero, would that individual develop a…

A: Men have noticeably more testosterone on average than women, despite the fact that testosterone is…

Q: Macmillan Learning Hominin is a group of species that includes modern humans and extinct human-like…

A: INTRODUCTION Primates : primates are mammal group including monkeys, apes and human.

Q: Amplitude pattern of the basilar membrane A 8000 Frequency 4000 2000 1000 600 400 200

A: Introduction: The principle:- The low- frequency sounds cause maximal activation of the basilar…

Q: About how many carbon (14) beta decays occur in your body every minute?

A: Carbon 14 has a half life about 5730 years where it is reached at its 50%. 8 thousands atoms decay…

Q: What is the difference between the loss of water between a plant that is outdoors and another that…

A: The physiological process by which water is lost in the form of vapour, from the living tissues of…

Q: what is natural sciences? what is the value of studying natural sciences and how useful it is to us…

A: Biology is one of the sub disciplines of natural science. Natural science comprises of both life…

Q: Bacterial cell walls are largely made of peptidoglycan, which is a O monomer, carbohydrate O…

A: Introduction :- Most bacteria's cell wall is made of peptidoglycan, also known as murein, an amino…

Q: Name the molecules that cycle thriught living systems

A: Living organisms continuously interact among themselves and also with their environment in order to…

Q: What evidence did Darwin use to support his theory of evolution by natural selection? Describe…

A: Traits are inherited by offspring from their parents. Changes in these traits over a period of many…

Q: Which of the following gene regulatory molecules act in trans. Check all that apply. The lac…

A: Introduction:- The gene regulatory molecules helps in regulating the expression of different genes,…

Q: A patient shows you a bottle of mouth rinse and asks you if it would be all right to use this mouth…

A: Basil sweet and peppermint are among the essential oils that can help with recovery. These oils can…

Q: Differentiate Invitrogen pCR® II-TOPO® Vector from pBR322 Vector.

A: Molecular cloning : Production of genetically identical copies of a cell or its genetic material is…

Q: Suppose you have a drug that specifically inhibits telomerase. You administer the drug to mice.…

A: Introduction :-   A significant ribonucleoprotein complex called telomerase is in charge of…

Q: Factions in our cells happen in a perfect way , therefore DNA replication is error free

A: Ans: DNA replication is defined as the process in which a double stranded DNA molecule is duplicated…

Q: Which of the following specifically explains why glucose uptake into intestinal cells happens in…

A: Active transport is selective and occurs against the concentration gradient. It is of two types…

Q: You cannot get a cavity, tetnus, or sinus infection from another person. This means that all of…

A: Tetanus is a disease of nervous system which is caused by a toxin producing bacteria. This disease…

Q: GENETICALLY MODIFIED CROP: mRNA 5' tRNA nucleus O Į CAGTTAATGGAGCGATGCCTGGATGGAGAAATCAATTAG nucleus…

A: The genetic code is a set of instructions that enable live cells to produce proteins using genetic…

Q: A. B. C. D. M C D A Membrane that contains proteins that bind and transport Acetyl CoA into…

A: Mitochondria is a cell organelle which can be found in eukaryotic organisms. *Mitochondria is the…

Q: Hydromorphone hydrochloride supposi- tories contain 3 mg of active ingredient and weigh…

A: 39. Given, hydromorphone hydrochloride suppositories contain : Active ingredient = 3mg, and  Total…

Q: On the diagram below, i) draw where the uncoupling protein must be located and ii) indicate the…

A: Electron transport chain:  A series of protein complexes that are generally found in the outer wall…

Q: Are the invertebrates polyphyletic, monophyletic, or paraphyletic? (all organimsms shown are…

A: The construction of phyllogenetic tree helps us identifying the common ancestor of them.…

Q: Which amino acid has a sulfur atom in its side chain and can form a disulfide bridge?

A: Introduction Amino acids are essential elements of the peptide sequences. Longer peptide sequences…

Q: Ozana was born with cataracts, which made her completely blind. When she was 14 years-old she…

A: Neuroplasticity, also known as brain plasticity, is the ability of the brain's biological, chemical,…

Q: You have two DNA samples. Only one was expected to have plasmid DNA that was isolated from it. Both…

A: Since only one out of two samples has plasmid DNA. The sample with DNA of other forms can be…

Q: Which of the following components found in the bone matrix make bone somewhat flexible and…

A:

Q: Assume that blood type is inherited as A and B dominant over O, but A and B are codominant over each…

A: Proteins for blood groupings such as A, B are present on the surface of red blood cells.

Q: CONCEPT APPLICATION 3. Imagine you are painting your bedroom at home. You get tired of repeatedly…

A: Introduction  Skeletal muscles, often known as muscles, are parts of the vertebrate muscular system…

Q: Describe four different uses for thoracic appendages seen in different crustaceans. Use specific…

A: Crustaceans form a large, diverse arthropod taxon which includes animals such as decapods, seed…

Q: Baltimore Oriole Black-backed Oriole Female Male Kondo, Baker, & Omland 2004 2B. Based on the…

A: The Baltimore oriole is a small icterid blackbird that is common in eastern North America as a…

Q: meaning of a life as a cell

A: Cell: It is defined as the fundamental unit of the life. It is the basic membrane-bound unit which…

Q: Being composed of molecules identical to certain ones already present in a host, the bacterial…

A: Bacterial capsule is usually made up of polysaccharides. Gram negative bacteria usually have capsule…

Q: Which of the following are major differences between DNA and RNA polymerases? RNA polymerase, but…

A: Both the polymerases are required for adding different nucleotides to the growing chain of the…

Defense Mechanism

Circumstances influence and compel people to behave in a certain way. One such behavior is a defense mechanism. It is employed by people to escape from unpleasant circumstances, thoughts and actions. Defense mechanisms are, thus, psychological strategies that help to avert and avoid unwanted feelings such as guilt or shame and situations such as threat and danger.