7. Using the diagram on the left, the molecule coded directly from DNA is represented by what number? O 02 O 3 04 1

Q: Describe the steps of DNA replication. ( keep it short please:) )

A: Why Replicate DNA? The DNA is the genetic material that is the defines in the every cell. Before the…

Q: Cloning vectors are not just limited to bacterial plasmids. Bacteriophages and M13 phage vectors are…

A: Introduction :- A cloning vector is a short bit of foreign DNA that can be injected for cloning…

Q: Oldfield mice that live on beaches of the gulf and Atlantic coast of Florida tend to white, wherease…

A: The oldfield mouse or the beach mouse is a nocturnal species of rodent in the family Cricetidae.…

Q: A) Identify the structures that would be found in proteins B) identify the structures that…

A: Introduction  Large biomolecules and macromolecules known as proteins are made up of one or more…

Q: What is the type of inheritance? What is known of the genotype of the male in the above cross? What…

A: Introduction  Genetics is frequently used to refer to heredity, which is the passing on of genetic…

Q: If C +T/A + G equals 0.5 in one strand, what is the ratio of these bases in the complementary…

A: Erwin chargaff in the year 1950 made quantitative analysis of DNA and showed that the composition of…

Q: the function of the cell membrane and pathogenicity of covid.

A: What are the Function of the cell membrane and pathogenicity of SARS-Cov2

Q: Describe the structural differences between the forewing and hindwing of Which wing is most…

A: INTRODUCTION-Jumping insects belonging to the grasshopper group (suborder Caelifera) are found in a…

Q: The digestive system has several important functions. The physiological processes involved  in the…

A: Food is broken down by the digestive process in the body so that it could be ingested and used as…

Q: BHI TTGTAAAACGACGGCCAGTGAGCGCGCGTAATACGACT M13-20 primer binding site Bsp 1061 goi Primer design…

A: It is required to use oligonucleotide primers while conducting a PCR reaction. Designing primers…

Q: 2) Concerning the figure below. $. 24 ACC GGGUA - AUG 17 lif UAA A) Which process is being…

A: Translation is the process by which ribosomes in the cytoplasm or endoplasmic reticulum make…

Q: The normal chromosome number of a spermatogonium in a male lynx is The Canada lynx has a diploid…

A: Chromosome are elongated thread like structure exhibited inside the nucleus of the cell. These…

Q: How does the digestive system of a nematode or annelid differ from that of a flatworm? In what ways…

A: Animals are eukaryotic structure, containing numerous cells , with absence of cell wall . Phylum…

Q: Caenorhabdiris elegant posses motor neurons called MNs. It has been determined that few cells known…

A: Neurons are the fundamental units of the brain and nervous system. These are the cells responsible…

Q: xplain how Protein Data Bank (PDB) can assist Dr.

A: protein data bank it enables science and education by providing access and tools for exploration,…

Q: (iii) (iv) What are the three (3) main cycles in PCR? Discuss the processes at each PCR cycle…

A: Polymerase Chain Reaction ( PCR) is a technique used to make millions or billions of copies of the…

Q: Plz answer this all questions    What muscle in the shark is homologous with the geniohyoideus in…

A: The common mudpuppy is a species of the salamander belongs to the genus Necturus. They live an…

Q: protein

A:

Q: Match each statement with the best possible single answer from the list below. Terms may be used in…

A:

Q: homology modelling and such are available free online. State the functions of CLUSTAL W, BLAST and…

A: Numerous computational methods are used in bioinformatics, that include sequence and structural…

Q: When complicated medical procedures simply do not work out due to their complexity, is it fair and…

A: Consent:  When one person voluntarily accepts another's request or wish, this is known as consent.…

Q: iii,iv ,v

A: i). The protein expression in the pET vector cultured in BL21(DE3). The IPTG induction at specific…

Q: Living modified organism (LMO) is defined as any living organism that possesses a novel combination…

A: Living modified organism means an organism which genetic materials has been altered artificially…

Q: Separation of homologous chromosomes during Meiosis I requires: Select one: a. Removing centromere…

A: A division in which diploid cell reduces the chromosome number into half by cell division and…

Q: If glycolysis has an overall –DG (i.e., it’s exergonic), why does it require an energy investment of…

A: Glycolyis can be defined as a process in which one mole of glucose is converted into two moles of…

Q: The dose of a drug is 500 mcg/kg of body weight. H ow many milligrams should be given to a child…

A: Given that, the drug dose is 500 mcg per kg of body weight and the weight of child is 55 lbs.

Q: Fatty acids activate Thermogenin, UCP-1 Channel H Hº H H H H' UCP-1 disturbs proton gradient H Hº H+…

A: Aerobic cellular respiration involves production of energy in the presence of oxygen from the…

Q: Explain your results when observations as stated below were obtained after the plasmids were…

A: DNA is a polymer composed of two polynucleotide chains that coil around each other to form a double…

Q: Explain how medical epidemiology is relevant to clinical practice.

A: Introduction :- Epidemiology is the study of the prevalence and causes of health-related conditions…

Q: Explain the neural basis of the Hermann Grid Illusion?

A: Please follow step 2 for detailed explanation.

Q: Which would be the control plate for the NaCl experiment and the Sucrose experiment and why?

A: Introduction:- control in an experiment usually set as a reference against which all other…

Q: Here is the sequence of one strand of a DNA molecule: GTC/ATG/CCC/AGA/CTA What is the DNA sequence…

A: DNA stands for deoxy ribonucleic acid and which is present in the nucleus that acts as a genetic…

Q: DNAT  A  C        C  G  C     T  C  C       G  C  C       G  T  C       G  A  C      A  A  T…

A: The self-replicating biomolecules  that are present in the chromosomes and carry genetic information…

Q: For the mutation of the enzyme, describe the effect it will have on carbohydrate metabolism. Also,…

A: Converting a catalytic cysteine into a serine or vice versa causes a significant decline in enzyme…

Q: a) Which strand is coding strand? b) What is the sequence of the encoded polypeptide? A mutant…

A: The central dogma of molecular biology involves the synthesis of a polypeptide chain of amino acids,…

Q: 16. What is the relationship between an organism's DNA and protein? DNA determines which RNA…

A: Introduction  Deoxyribonucleic acid is a polymer made of two polynucleotide chains that coil around…

Q: Which of the following components found in the bone matrix make bone somewhat flexible and…

A:

Q: SDS-PAGE is a technique that allows you to do which of the following? Separate proteins based on…

A: Proteins are made up of amino acids that are bounded together by peptide bonds. Different proteins…

Q: You have two DNA samples. Only one was expected to have plasmid DNA that was isolated from it. Both…

A: Since only one out of two samples has plasmid DNA. The sample with DNA of other forms can be…

Q: methods to introduce gene of interest into plant cells for the production of transgenic crops.

A:

Q: Consider the image below. This image shows plasmid DNA isolated through exactly the same method that…

A: Plasmid DNA In contrast to a cell's chromosomal DNA, plasmidsare tiny, circular, double-stranded DNA…

Q: 14. The table below shows the percentage of Thymine (T) A C search 15% 30% 50% T 20% 60% O G C m…

A: Introduction :- One of the four nucleobases in DNA's nucleic acid, represented by the letters…

Q: When two molecules of glucose go through glycolysis, how many molecules of pyruvate are formed? a.…

A: Please follow step 2 for detailed explanation.

Q: Below is an image of translation occurring in the direction indicated by the arrow. Use the image…

A: An arrow has been given that signifies in which direction, translation is happening. Translation…

Q: Differentiate Invitrogen pCR® II-TOPO® Vector from pBR322 Vector.

A: Molecular cloning : Production of genetically identical copies of a cell or its genetic material is…

Q: NoCases 8000- 6000- 4000- 2000- 0- Apr 2020 Jul 2020 Oct 2020 DateRepConf Jan 2021 . Apr 202

A: The SARS-CoV-2 virus is the infectious disease known as coronavirus disease (COVID-19). The majority…

Q: An inve erozygote has the Centromere A B JI HGF ED ing inverted chr Inverted region CKLM What would…

A: As the inversion is in heterozygote condition that means one chromosome contains all dominant…

Q: QUESTION 45 Which of the following statements is FALSE? Low oxygen levels in the blood increase…

A: Introduction: The body's cells require energy for metabolism, that is supplied by the blood from the…

Q: 2. Why did the reindeer grow at this rate?

A: An organism's "niche" is defined by the collection of circumstances, supplies, and relationships…

Q: 7. Match the bases: Adenine, thymine, cytosine and guanine as found in DNA. 8. Which sugar is found…

A: Biomolecules are the most important organic compounds that are engaged in the upkeep and metabolic…

Genome annotation

The technique of linking biological information to genome sequences is termed genome annotation. Gene annotation is the method of identifying gene locations and coding sections. It helps us understand what these genes are doing in the body through establishing structural characteristics and linking them to the actions of various proteins.