A lilP mutant called lilPXS is isolated that produces a truncated polypeptide of only 6 AA in length. Describe a single basepair DNA change that would lead to this truncated version of the protein. Multiple options are possible
Q: In this DNA replication bubble, label the 5' and 3' ends of each of the two parent strands (labeled…
A: Replication bubble is a structure formed during DNA replication in which the two strands of…
Q: Question 35. Theoretically, the PCR process is a true chain reaction but in reality, this is not the…
A: PCR stands for Polymerase Chain Reaction. It is a laboratory technique used to amplify a small…
Q: What causes the cell to have different structure and function
A: Introduction: A cell is the basic structural and functional unit of all living organisms. It is the…
Q: Decide which sentences describe natural selection and which are common misconceptions. True…
A: Natural Selection: Natural selection is a process by which certain heritable traits become more or…
Q: What are 3 ways disinfectants work to destroy bacteria?
A: Introduction: Disinfection is the process of eliminating or reducing the number of microorganisms,…
Q: Methods for determining the sensitivity of bacteria to antibiotics. The concept of minimum…
A: The sensitivity of a microorganism to any antimicrobial agent like antibiotics depends on the…
Q: 1. The nonfunctional pelvis and hind limbs found in some snakes support which statement about…
A: Evolution: Evolution is the process by which living organisms change over time through the…
Q: DNA is less susceptible than RNA to alkaline hydrolysis. Which of the following is the most…
A: Introduction: DNA and RNA are both nucleic acids, which are the fundamental building blocks of life.…
Q: Which of the following statements regarding Antidiuretic Hormone signaling is false? - it involves…
A: Introduction :- ADH is a hormone produced in the hypothalamus and released from the posterior…
Q: Topic: My 600 life Ib life In a paragraph write your thoughts on their stories. What nutrition…
A: Introduction Nutrition refers to the study of how food and nutrients impact human health and…
Q: QUESTION 10 Which imaging method would give you the technical ability to view the details of the…
A: Differential interference contrast (DIC) microscopy is a type of light microscopy technique that…
Q: What is the population that is most affected from Unintentional injuries from a vehicular accident…
A: Introduction: motor vehicle accidents are a major public health issue that affects millions of…
Q: In a cross between a+/+b and ab/ab flies, what proportion of the progeny would you expect to have a…
A: An individual who exhibits the usual phenotype, which is the phenotype typically present in a…
Q: In populations where it is common for first cousins to marry, some autosomal recessive disorders…
A: Introduction : According to the Hardy-Weinberg principle, the frequency of the allele in a…
Q: Mention 3 research articles on lameness in dairy cows.
A: Lameness in dairy cows is typically brought on by an illness or injury to the leg or hoof. It may…
Q: Separation of very large DNA fragments Answer 1 Inbreeding Answer 2 Autosomal dominant disorder…
A: The study of living things is done by the natural science field of biology. Individual biologists…
Q: 4. Antimicrobial Can horizontal bacteria? why? resistance is caused by bacterial mutations. gene…
A: Horizontal gene transfer refers to the process by which genetic material is transferred between…
Q: https://moodle.swarthmore.edu/pluginfile.php/83002/mod_resource/content/0/Scheper-Hughes,%20Lock-%20…
A: INTRODUCTION The article "The mindful body: A prolegomenon to future work in medical anthropology"…
Q: What illness/disease does the presence of E. coli in a wound swab indicate?
A: E. coli is also known as Escherichia coli, is a type of bacteria found in the intestines of humans…
Q: Chemiosmosis and the electron transport chain are critical to the generation of ATP for both aerobic…
A: Cellular respiration involves breakdown of glucose and production of energy (ATP) either in the…
Q: 3 main types of genetic recombination
A: Genetic recombination is the process by which genetic material, typically DNA, is exchanged between…
Q: G. H. I. Since Huntington's disease is caused by a dominant allele, this mean that it's better to…
A: Huntington's disease: Huntington's disease is a genetic disorder that affects the brain and…
Q: 3. Were you able to distinguish between G+ cells and G- cells? Give the gram reactions of E. coli…
A: Gram staining is a common laboratory technique in microbiology that helps in the classification of…
Q: A. The majority of the antibiotics we use are made by a single bact erial genus, so what does it…
A: Antibiotics: Antibiotics are a class of drugs used to treat bacterial infections. They work by…
Q: On immune cells: Microphages or dendritic cells Activation and proliferation of "naive" B cells by…
A: Immunity refers to the ability of an organism to resist or defend against infectious diseases and…
Q: 15. Which of the following rows provides the probable percentage of this population with each…
A: The given questions are related to the population genetics and population ecology. The study of…
Q: Some drugs require rectal administration because * they can undergo first-pass metabolism. O small…
A: Introduction :- Drugs are chemical substances that alter the normal function of the body when they…
Q: When your white blood cells encounter pathogens, they use harsh chemical reactions to destroy…
A: Vitamin C is also known as Ascorbic acid ( a water soluble vitamin), which plays vital role in…
Q: Which of the following best describes the fatty acid 20:3n-4? A. There are 20 carbons plus three…
A: Introduction Fatty acids are a type of organic molecule that is an essential component of many…
Q: The frequency of the defective allele of a gene for an autosomal dominant disorder is 1/5. In a…
A: Introduction An autosomal dominant disorder is a genetic disorder caused by a mutation in a gene…
Q: Explain why it has been very difficult to obtain an X-ray crystal structure for the complete nuclear…
A: A substantial and intricate protein structure called the nuclear pore complex (NPC) covers the…
Q: In what ways do you think increasing diversity in genetic studies can improve healthcare outcomes…
A: Genetic diversity refers to the variety of genetic material within and among populations of…
Q: In a classic experiment in photosynthesis performed in 1883 by the German botanist Thomas Engelmann,…
A: Algae are a diverse group of aquatic, photosynthetic organisms that are classified as neither plants…
Q: Identify the objectives and methodology of the article below:…
A: Introduction Antibiotics are a class of drugs used to treat bacterial infections. They work by…
Q: Explain Clostridium botulinum
A: Bacteria are single-celled microorganisms that lack a nucleus and other membrane-bound organelles.…
Q: What is the unknownn organism based on this biochemical test results? Gram Stain: Gram Positive…
A: Introduction: Gram staining is a laboratory technique used to differentiate bacterial species into…
Q: Make a presentation using the ecosystem to show the interrelationship of animals and plants. It…
A: An ecosystem is a complex network of living organisms, their physical environment, and the…
Q: Question 8. In a patient that has a mutation in the enzyme that adds phosphate groups to the mannose…
A: A mutation is a change in the DNA sequence of a gene or chromosome. Mutations can be caused by…
Q: 5✓ The two central (a) Carbons: IX A Carbon atom in each side chain: The peptide bond is between…
A: Introduction : Hydrogen bonds within the polypeptide chain create the secondary structure of a…
Q: RGS proteins accelerate the GAP activity of Gα subunits. What is the direct result of this GAP…
A: Introduction :- G proteins are signaling molecules that play a critical role in the transmission of…
Q: A couple is concerned their child will be born with sickle cell anemia. The woman does not have…
A: A mutant form of haemoglobin is the root cause of the hereditary condition known as sickle-cell…
Q: responsible for transmitting a large fraction of vector-borne diseases.
A: INTRODUCTION Dipterans, also known as flies, are a diverse group of insects belonging to the order…
Q: Fill in the letter (a, b, c, d, or e) showing the locations where each of the following enzymes…
A: DNA replication is the mechanism by which a cell duplicates its genetic material. It is a…
Q: primary and metastatic uveal Mel202 and OMM1.3 cells.
A: NOTE- AS PER OUR BARTLEBY GUIDELINES , IF MULTIPLE QUESTIONS ARE GIVEN WE HAVE TO SOLVE ONLY FIRST…
Q: Molecule X MMP-2 cleavable sequence Molecule Y
A: The imaging agent in the figure consists of two molecules - molecule X (donor) and molecule Y…
Q: The genes for waltzer (v) and jittery (ji) are 18 map units apart on chromosome 10 in mice. A…
A: To produce mice with the desired genotype of waltzer, jittery, and waltzer + jittery, we need to…
Q: 7. What effect did the carboxymethylcellulose have on the organisms and why? Organism Algal sample…
A: Introduction Carboxymethylcellulose, also known as CMC, is a water-soluble cellulose derivative…
Q: QUESTION 22 Which compartments are topologically equivalent with the nucleus? OA. ER and…
A: Introduction : Cell organelles are specialised subunits that carry out particular activities and…
Q: Click to go forward, hold to see…
A: Cell membrane is a semi permeable that allows only certain molecules to pass through and the…
Q: 3. Describe the steps in a second messenger pathway: You may use the cAMP pathway or the cGMP…
A: Introduction: An internal signalling pathway known as a second messenger pathway amplifies and…
Step by step
Solved in 2 steps
- The bacterial gene shorty (sh) encodes for a small protein. The DNA sequence of the sh gene is shown below. The ORF is in CAPITAL LETTERS 5’-tataatgggcttaacaATGAGTAAAAGAGGTCCTTTACTCCGGTATCACCAATAGaaatattatttaa-3’ 3’-atattacccgaattgtTACTCATTTTCTCCAGGAAATGAGGCCATAGTGGTTATCtttataataaatt-5’ Answer the following questions: Q1. Which is the coding strand? Which is the template strand? [10%] Top-bottom. Bottom-Top. Both can be used as either coding or template for this gene.The bacterial gene shorty (sh) encodes for a small protein. The DNA sequence of the sh gene is shown below. The ORF is in CAPITAL LETTERS 5’-tataatgggcttaacaATGAGTAAAAGAGGTCCTTTACTCCGGTATCACCAATAGaaatattatttaa-3’ 3’-atattacccgaattgtTACTCATTTTCTCCAGGAAATGAGGCCATAGTGGTTATCtttataataaatt What is the length in AA’s of the Sh protein? Assume fMet is NOT CLEAVED [10%] 39 AA 13 AA 12 AA 21 AAThis is part of the Escherichia coli DNA sequence that contains an inverted repeat. (Note: top strand is the coding strand). 5'-AACGCATGAGAAAGCCCCCCGGAAGATCACCTTCCGGGGGCTTTATATAATTAGC-3' 3'-TTGCGTACTCTTTCGGGGGGCCTTCTAGTGGAAGGCCCCCGAAATATATTAATCG-5' (i) Draw the structure of hairpin loop that will be formed during the end of transcription. (ii) Describe the function of the hairpin loop during transcription.
- Based on sequences A,B,C. Provide an anticodon sequence that would build this protein. Sequence ATCTTCCCTCCTAAACGTTCAACCGGTTCTTAATCCGCCGCCAGGGCCCCGCCCCTCAGAAGTTGGTSequence BTCAGACGTTTTTGCCCCGTAACAACTTGTTACAACATGGTCATAAACGTCAGAGATGGTCAATCTCTTAATGACTSequence CTACAAACATGTAAACACACCCTCAGTGGACCAACTCCGCAACATAAACCAAACACCGCTCGCGCCGAAAAAGATATGG3’ TACAATGGGCGACGCGCTTCGTTTCAGATT 5’ 5’ ATGTTACCCGCTGCGCGAAGCAAAGTCTAA 3’ Make vertical lines between codons to make this assignment easier to do. Which strand is the template strand? The first strand is the template strand as it going 3-5 Copy the template strand in mRNA. Label the 5’ and 3’ ends. 5' AUG UUA CCC GCU GCG CGA AGC AAA GUC UAA 3” Write out the amino acid (you can use the short form) that this protein would be made of (keep in mind proteins are usually a minimum of 50 proteins. Met-Leu-Pro-Ala-Ala-Arg-Ser-Lys-Val What do you notice about the mRNA strand compared to the non template strand of DNA? 2. What amino acid does the second codon code for on the DNA template strand? ______Assume the 6th amino acid in the strand is changed from a T to a C. What amino acid does it code for now? _______ What type of mutation is this? 3. Assume the 6th amino acid is changed from T to G on the DNA template strand. What type of mutation is this? What effect would…Figure 1 is a bacterial gene (1-180). The first base to be transcribed is the base located at position 77. 45 5' TTGGT CTTGG TCGGA TTCCA GAGGA TGAAG TGTTG ACAGC GCATT 3' 3 AACCA GAACC AGCCT AAGGT CTCCT ACTTC ACAAC TGTCG CGTAA 5' 46 5 AATTG ACCTT GCTGT ATTAT AGCCA AGGAC AGATC TACGA GCATG 3' 3 TTAAC TGGAA CGACA TAATA TCGGT TCCTG TCTAG ATGCT CGTAC 5' 91 5 TGCGA ACCGC AAGCA TTCGT TCTCC TAGGC TACTC GATCC CGTAA 3' 3 ACGCT TGGCG TTCGT AACCA AGAGG ATCCG ATGAG CTAGG GCATT 5 77 90 110 135 136 5 TGATG TAGCT GATTC TGTTG AAAGG CTCCT TTTGG AGCCT TTTTT 3 3' ACTAC ATCGA CTAAG ACAAC TTTCC GAGGA AAACC TCGGA AAAAA 5 156 180 Figure 1. Illustrate how termination of transcription occurs in the gene above. (Hint: position from 156 to 180)
- What is the sequence of the mRNA transcript that will be produced from the following sequence of DNA? The top strand is the template strand, the bottom strand is the coding strand. 5’ – TCGGGATTAGACGCACGTTGGCATACCTCG – 3’ 3’ – AGCCCTAATCTGCGTGCAACCGTATGGAGC – 5’ Enter the mRNA sequence here (pay close attention to the direction of the molecule!): 5'-_____-3'what is the anticodon sequence that would build this protein? AUGUUUGUACAUUUGUGUGGGAGUCACCUGGUUGAGGCGUUGUAUUUGGUUUGUGGCGAGCGCUUUUACCAGUUAGAGAAUUACUGA5'-TAGCTGATCGAATATGCGGTCTCTATCTTCGTAGACGA-3' 3'-ATCGACTAGCTTATACGCCAGAGATAGAAGCATCTGCT -5' Determine the amino acids that will be encoded by this sequence Second letter First letter U C A G U UUU Phe UUC UUA UUG Leu CUU CUC CUA CUG Leu GUU GUC GUA GUG Val UCU UCC UCA UCGJ AUU AUC lle AUA ACA AUG Met ACG CCU CCC C CCA CCG ACU ACC GCU GCC GCA GCG Ser - Pro Thr Ala A UGU UACTyr Cys UGC. UAA Stop UGA Stop A UAG Stop UGG Trp G CAC His CAA Gin CAG GAUT GAC Asp GAA AAU Asn ACC Ser AGU AAG LYS AA Glu GAGJ Oa. N-Met-Arg - Ser-Leu-Ser - Ser-C Ob. N-Met-Pro-Arg - Asn-Asp - Ser-C d. N-Met-Lys - Val-Glu-Ala-C Oc. N-Asp-Pro-Lys - Ser - Val-Ile-C Oe. N- Met-Ala-Asp-Pro-Lys - Ser-C G CGU CGC CGA CGG AGA AGG. GGU GGC GGA GGG Arg SCAO Gly U UCAG UUA DUAG Arg G Third letter 13
- Transcribe the following DNA sequence into RNA, and then into amino acids 5’-GTATACTTGTGGGCCAGGGCATTAGCCACACCAGCCACCACTTTCGGATCGGCAGCC-3’ 3’-CATATGAACACCCGGTCCCGTAATCGGTGTGGTCGGTGGTGAAAGCCTAGCCGTCGG-5’17) Synthesis of the mRNA starts at the boxed A/T base pair indicated by the box and proceeds left to right on the sequence below. Transcribe and translate this bacterial gene. 5'-GGACCGCGGGGCAGGATTGCTCCGGGCTGTTTCATGACTIGICAGGTGGGATGACTTGGATGGAAAAGTAGAAGGTCATG-3 3'-CCTGGCGCCCCGTCCTAACGAGGCCCGACAAAGTACTGAACAGTCCACCCTACTGAACCTACCTTTTCATCTTCCAGTAC-5′ 1 -+--at - --+-- 80What’s the resulting amino acid sequence? 3’CAG TTA AGC CTC GGT TAC CAG GAT ACG GGA 5’