aQUESTION 7Please read the paragraph regarding transcription termination and fill in the blanks with words from the word bank below(not all of the words will be used):Rat1ATPAdenosineAAUAAARhoTATAA-siteRNA polymeraseUracilRut siteGuanosineHairpinThere are two known mechanisms of transcription termination in prokaryotes. One mechanism requires a proteincomplex calledThis protein complex binds to thewhich islocated on the RNA that is being transcribed. This protein complex then moves toward the stalled RNA polymerasecomplex and unwinds the RNA from the DNA. A second mechanism for termination in prokaryotes requires an RNAtermination sequence that contains a secondary structure called afollowed by a string ofnucleotides.Transcription termination for RNA Polymerase II in eukaryotes happens when the termination consensus sequence,is transcribed leading to cleavage of the mRNA 11-30 nucleotides downstream of thetermination sequence. Once cleavage occurs,binds to the 5' end of the mRNA that is stillattached to the RNA polymerase/DNA complex and degrades the remaining mRNA. This leads to the dissociation of theRNA polymerase from the DNA.

There are two known mechanisms for transcription termination in prokaryotes. One mechanism requires…

Answered: a QUESTION 7 Please read the paragraph…

Biochemistry

6th Edition

ISBN:9781305577206

Author:Reginald H. Garrett, Charles M. Grisham

Publisher:Reginald H. Garrett, Charles M. Grisham

Chapter29: Transcription And The Regulation Of Gene Expression

Section: Chapter Questions

Problem 1P

See similar textbooks

Similar questions

Transcription AttenuationHow would transcriptionof the E. coli trp operon be affected by the following manipulations of the leader region of the trp mRNA?(a) Increasing the distance (number of bases) betweenthe leader peptide gene and sequence 2(b) Increasing the distance between sequences 2 and 3(c) Removing sequence 4(d) Changing the two Trp codons in the leader peptidegene to His codons(e) Eliminating the ribosome-binding site for the genethat encodes the leader peptide(f) Changing several nucleotides in sequence 3 so thatit can base-pair with sequence 4 but not with sequence 2
46What is the A-site of the ribosome? A.exit siteb.aminoacyl-tRNA binding sitec.peptidyl-tRNA binding siteD.peptidyltransferase site 47This sequence motif, which is called the ( ) , is usually located 25 to 30 bp upstream from the transcription initiation site. 48Pre-mRNA requires specific sequences for precise __________ to occur. A.splicingb.taggingc.replicationD.skipping
In eukaryotes, transcription initiation involves enhancersequences located far from the promoter. In addition, thechromatin of eukaryotic chromosomes must be unwoundto allow access by _________?
67RNA interference was first discovered in Drosophila melanogaster. Yesorno 68Which of the following is required for the bacterial ribosome complex to disassemble?A.EF1A-GTPb.Signal sequencec.Release factorD.EF1B 69A transcription unit must have an initiation signal called a _____________ for accurate and efficient transcription to take place. A.transcription start siteb.promoterc.transcription initiation factorD.ori
In vitro translation systems have been developed inwhich specific RNA molecules can be added to a testtube containing a bacterial cell extract that includes allthe components needed for translation (ribosomes,tRNAs, amino acids). If a radioactively labeled aminoacid is included, any protein translated from that RNAcan be detected and displayed on a gel. If a eukaryoticmRNA is added to the test tube, would radioactive protein be produced? Explain.
73Dicer catalyzes Sequence-dependent single-stranded RNA cleavage. Yesorno 74Amino acid-coding regions within eukaryotic genes may be interrupted by ___________ regions. A.noncodingb.long terminal repeatc.split geneD.enhancer 75Which of the following cleaves the N-terminal methionine from polypeptides?A.Methionine isomeraseb.Methionine aminopeptidasec.Methionine carboxylaseD.Methionine transferase
The following DNA nucleotides are found near the end of a bacterial transcription unit. 3′–AGCATACAGCAGACCGTTGGTCTGAAAAAAGCATACA–5′ a. Mark the point at which transcription will terminate. b. Is this terminator rho independent or rho dependent? c. Draw a diagram of the RNA that will be transcribed from this DNA, including its nucleotide sequence and any secondary structures that form.
Q: on Transcription process Briefly describe the differences in the transcription and translation processes as they occur in prokaryotic cells and eukaryotic cells. Thank you very much for your help.
Some transcription regulators bind to DNA andcause the double helix to bend at a sharp angle. Such“bending proteins” can affect the initiation of transcrip-tion without directly contacting any other protein. Can youdevise a plausible explanation for how such proteins mightwork to modulate transcription? Draw a diagram that illus-trates your explanation.
88Sequential binding of RNA polymerase II-TFIIF complex, TFIIE, and TFIIH completes ___________________ formation. A.pre-initiation complexb.TF recognition elementc.pre-elongation complexD.TATA binding complex 89Which of the following is the GDP-GTP exchange protein?A.EF-Tub.none of the abovec.EF-TsD.EF-G 90RNA polymerase II has 14 subunits. Yesorno
Shown below is a portion of a wild-type DNA sequence that encodes the last amino acids of a protein that is 270 amino acids long. The first three bolded base pairs indicate the frame and include the coding region. 5^ ...GCTAAGTATTGCTCAAGATTAGGATGATAAATAACTGG 3^ 3^.. CGATTCATAACGAGTTCTAATCCTACTATTTATTGACC 5^ Which strand is the template strand for transcription of this gene? Briefly explain how you know. An insertion of one base pair causes the protein to decrease in length by seven amino acids. With respect to the sequence given above, where does this insertion occur? A change of one base pair leads to the protein increasing in the length by one amino acid. With respect to the sequence given above, which base pair would you change, and what would you change this base pair for the protein to increase in the length by one amino acid?
Consider the Rho-dependent terminator sequence 5’CCCAGCCCGCCUAAUGAGCGGCCUUUUUUUU-3’. What affect would a point mutation at any one of the bolded and underlined nucleotides disrupt termination of transcription? Group of answer choices Mutation in one of these nucleotides would disrupt base pairing, preventing the formation of the hairpin and disrupting termination. Mutation in one of these nucleotides would have no affect on base pairing, so the termination hairpin is formed and termination proceeds. Mutation in one of these nucleotides would not disrupt base pairing, but would prevent the formation of the hairpin and disrupt termination. Mutation in one of these nucleotides would disrupt base pairing, but not affect the formation of the hairpin and termination proceeds.

SEE MORE QUESTIONS

Recommended textbooks for you

Biochemistry

ISBN:

9781305577206

Author:

Reginald H. Garrett, Charles M. Grisham

Publisher:

Cengage Learning

Biochemistry

ISBN:

9781305577206

Author:

Reginald H. Garrett, Charles M. Grisham

Publisher:

Cengage Learning

SEE MORE TEXTBOOKS