An action potential is shown below. Number 4 on the graph is showing which phase? 3 Membrane potential (mv) 50 -70 2 4 O pre-polarization 5 1 Ohyperpolarization Oresting potential denaturation repolarization depolarization peak of action potential 2 3 Time (msec) 4

Q: Alveolar type Il cells are: Select one: a. squamous cells involved in gas exchange b. columnar cells…

A: A pulmonary alveolus, also known as an air sac or air gap, is one of the lungs' millions of hollow,…

Q: Fetal hemoglobin has a higher affinity for oxygen than mother's hemoglobin due to inability of fetal…

A: Hemoglobin is a conjugated protein with four polypeptide chains. It facilitates the transport of…

Q: In a lab, researchers induced a mutation to the Gal3 gene in yeast. The original sequence of the…

A: DNA ( Deoxyribonucleic acid ) is two stranded ladder like helical structure which acts as genetic…

Q: To examine: Whether the given statement, "most of the DNA sequences in a bacterial genome code for…

A: Nucleic acids are genetic material that can be passed down through generations. Nucleic acids are…

Q: Mutations caused by insertion of a DNA transposon are often genetically unstable, reverting to…

A: if a DNA transposon is inserted into DNA it causes mutations. these type of mutations are not…

Q: Instruction - Please answer them correctly - Please answer all of them, they are connected. PEDIGREE…

A: (According to Bartleby guidelines, only the first three subparts have been answered. Kindly post the…

Q: To examine: Whether the statement, "Animals and plants use oxidation to extract energy from the food…

A: ATP, or adenosine triphosphate, is an organic molecule that is responsible for providing energy…

Q: Because the Laetoli footprints date to 3.6 mya and they are clearly made by a bipedal hominin, it is…

A: Introduction Bipedalism:- It is a form of terrestrial locomotion where an organism moves by means of…

Q: Why do you think celiac disease causes several types of symptoms and potentially serious…

A: Introduction Autoimmune diseases:- It is a condition when your immune system attacks healthy cells…

Q: Involuntary muscle consisting of spindly shaped cells without striations is called: cardiac muscle.…

A: Involuntary muscles are those that do not move or contract under a person's conscious control, i.e.,…

Q: 11. What is a typical characteristic of an r-selected species? a. boom-and-bust popuation growth…

A: The r/K selection hypothesis in ecology refers to the selection of features in an organism that…

Q: In the presence of lactose and the presence of glucose the lac operon is not expressed Lacl is bound…

A: Introduction:- Lactose metabolism genes are found in the lac operon of E. coli. It is only expressed…

Q: What is the name of the "law" described by the formula in (1) (where R is how related two…

A: The reproductive benefit here means that one organism can pass its genes to future generations by…

Q: Biology ex. Locate any woodland or forest area close to your home. Create a 10 x 10 m quadrat once…

A: Information gathering and literal search are usually done in research processes. It is the process…

Q: Compare the two mRNA sequences below. AUAUUCGGCAAUCCG AUAUUCCGCAAUCCG This change could be the…

A: Messenger RNA or mRNA is single stranded RNA which acts as template for the synthesis of amino acids…

Q: Skeletal muscle contraction requires: O calcium ions O ATP O arrival of a nerve impulse all the…

A: Skeletal muscle is composed of muscle fibres which have smaller units called myofibrils. There are…

Q: You and your lab partner ran a simulation to demonstrate the changes in allele frequency over time…

A: Allele frequencies in large and small population.

Q: To explain: The extraordinary mutation resistance of the genetic code argues in favor of its origin…

A: The hereditary unit of most organisms is DNA. It is transcribed into mRNA by a transcription…

Q: What can happen if you get an antibiotic-resistant infection? O You may have a longer-lasting…

A: The correct answer choice is - all of the above.

Q: How do you induce a plant to flower?

A: Introduction Flower:- It is the reproductive structure found in flowering plants (plants of the…

Q: 2. Does the FITT formula help you build physical fitness? Why or why not?

A: Introduction Any physiological action that improves or maintains physical fitness and general health…

Q: f the lophophore is absent in brachiopods, would you consider them to be members of Mollusca? Why or…

A: Definition: - A lophophore creates a continuous, laminar water flow, induced by the lateral cilia on…

Q: 5’ UGG CAA UCC UAC GAU 3’   Write out the sequence of the anticodon in the tRNA that would bind to…

A: In molecular biology, messenger ribonucleic acid is a single-stranded RNA molecule that corresponds…

Q: Your friend is convinced his calico cat is male. He takes the cat to the vet. Sure enough the cat is…

A: A calico cat is a domestic cat of any breed with a tri-color coat.

Q: Name the airways in the mammalian lung. What are their functions? How does air enter and leave the…

A: In mammal the respiratory system exchanges gases with the surroundings. Once air enters through the…

Q: S-TAGTAGGOOGCATOTTTTCCCATACAGATGAAGGATAAACTCGTCTXTAT-3 [x]-cleavage site for CFICFII endonuclease…

A: DNA ( Deoxyribonucleic acid ) is two stranded , ladder like helical structure that functions as…

Q: Which of the following statements about mRNA is correct? a. Eukaryotic mRNA is generally…

A: Introduction:- Ribonucleic acid (RNA) is a nucleic acid that has structural similarities to DNA and…

Q: 2. Symbiosis. Describe the interaction of species by supplying Species A and B with proper…

A: Symbiosis is a close and long-term association between two individuals of different species and as a…

Q: What is the importance of feedback systems in the control of hormonal output in mammals? Offer two…

A: A feedback mechanism is a loop in which a product feeds back to control its own production.

Q: If a person exercises to achieve bigger muscles, what effort must be exerted and what actually…

A: Introduction: The amount of force a muscle can create in a single effort is known as muscular…

Q: To determine: The special properties that an enzyme isolated from a psychrophilic bacterium will…

A: Enzymes are biocatalysts that aid in the acceleration of the reaction. They are proteins that help…

Q: . Differentiation of the Spemann’s primary organizer requires which of the following?* a.…

A: Spemann’s primary organizer are the transplanted tissue of early gastrulas and its dorsal lip used…

Q: An individual presents with cardiac tamponade.  Their heart would be the most efficient in pumping…

A: cardiac tamponade is a medical condition where there is build up of fuilds in the pericardial sacs.…

Q: membranes line the cavities between bones in moveable joints. O Mucous O Serous Cutaneous O Synovial

A: It is important to know that a thin layer of cells cover the skin (outer layer of body),…

Q: Choose one of the small molecules. List what it's macro- molecule Structure is and describe how the…

A: Glucose molecules- is one of smallest molecules and it provides energy, from the structure of the…

Q: Your friend is convinced his calico cat is male. He takes the cat to the vet. Sure enough the cat is…

A: Introduction : The coat of calico cats is tricolored. Because of their X chromosome, they are…

Q: A. For each of the following nucleotide sequences, determine the amino acid sequence. 1. 5'…

A: Introduction Amino acids are molecules that combine to form proteins, They build muscles, prevents…

Q: Isabella, 28, andOmar, 30, have been together for three years. A year ago, they decided they wanted…

A: Fertilisation: Fertilisation occurs when a sperm fuses with the female egg after the intercourse…

Q: Humans have employed biotechnology since ancient times to breed animals and improve their crops.…

A: Biotechnology means the branch of science which uses living organisms by combining natural science…

Q: Three weeks ago, 20-year-old Sacheen came down with symptoms typical of the common cold. She had a…

A: Bronchitis disease and it's effect on patient.

Q: The stage micrometer is 1 mm long with 1000 divisions. Under HPO, aligning it with an eyepiece…

A: In the microscope, there is a stage ruler and an eyepiece ruler. The image size of any specimen is…

Q: 18-year-old Gabrielle checks her calendar. It has been 42 days since her last menstrual period, two…

A: Polycystic ovary syndrome is a hormonal disorder which results into lot of cyst presented in…

Q: QUESTION 1 You are studying a mutant strain of e.coli. When you add lactose to the media of this…

A: Lac operon is the segment of DNA which is involved in the breaking down of lactose into glucose in…

Q: Most land animals with exoskeletons are smaller than the volume of a mouse, and most vertebrates are…

A: Insects belong to the phylum Arthropoda and it is the largest phylum in the animal kingdom…

Q: The diagram below shows some of the major organs involved in human digestion.

A: DIGESTION Digestion is important for breaking down food into nutrients, which the body uses for…

Q: The Ardipithecus ramidus specimen, nicknamed Ardi, was a great find because it contained a large…

A: Ardi It refers to the fossils of Ardipithecus ramidus. It is considered as an early human-like…

Q: To determine: The term pacemaker enzyme.

A: The feedback control ensures that the end product of a specific pathway has a balanced ratio. This…

Q: Transcribe and Translate the origininal DNA sequence, then in mutated dna sequence identify the Mrna…

A: Since you have asked the multipart question, we will solve the first three questions for you. If you…

Q: Which of the following cells form new bone in bone tissue? osteons O osteoblasts osteocytes O…

A: The cells that forms new bone in bone tissue are osteoblasts.  Explanation :  Osteoblasts are the…

Q: What is the function of a helper T cell? OA. to destroy cells that are already infected OB. to…

A: Helper t cells are helpful in adaptive immunity in our body. These cells recognise foreign antigens…

Microbial Taxonomy

Taxonomy is the science of naming, classifying, and describing organisms. The taxonomy will include all the plants, microorganisms, and animals on this planet. Carl Linnaeus coined the taxonomy term. He is known as the father of taxonomy. Microbial taxonomy is a criterion of grouping microorganisms into groups based on their similarities and past relatedness. Microorganisms belonging to the same group are differentiated from the others via grouping into categories. This differentiation makes the study of microorganisms easy. There are different types of microbial taxonomies like Numerical and Molecular taxonomy. The study of microorganisms is known as microbiology. Microbiology is a broad term that takes into account microbial cultures, taxonomic studies, evolutionary relationships. Microbial interaction and diversity are huge data that needs to be compiled under the subject of microbiology. Microbiology covers various organisms like bacteria, fungi, algae, plants, animals, etc.