12:14An edible vaccine has been created againstSelect one:O a. HIV, not approvedO b. HIV, approvedO C.the swine flue, not approved... 5and is currently.O d.the plague which caused the Black Death, not approvedO e. the plague which caused the Black Death, approved×by the FDA.

The idea of an edible vaccination has recently gained traction thanks to biotechnologists. Subunit…

An edible vaccine has been created against Select one: O a. HIV, not approved O b. HIV, approved O c. the swine flue, not approved and is currently. O d. the plague which caused the Black Death, not approved O e. the plague which caused the Black Death, approved by the FDA.

An edible vaccine has been created against Select one: O a. HIV, not approved O b. HIV, approved O c. the swine flue, not approved and is currently. O d. the plague which caused the Black Death, not approved O e. the plague which caused the Black Death, approved by the FDA.

Biology: The Dynamic Science (MindTap Course List)

4th Edition

ISBN:9781305389892

Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Publisher:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Chapter45: Defenses Against Disease

Section: Chapter Questions

Problem 11TYK

See similar textbooks

Related questions

Q: Bascillus bacteria is of which shape? a- rod shape b- spring like c- circle shape d- oval shape

A: Small, single-celled organisms called bacteria exist. Nearly all areas of the world are home to…

Q: How can healthcare professionals find a balance between protecting public health and maintaining…

A: Healthcare professionals should be familiar with and adhere to legal and ethical guidelines such as…

Q: Please write/describe at least four criteria that make a target druggable and describe with example…

A: In the field of drug discovery and development, identifying and selecting appropriate targets for…

Q: Describe how the antigenic components of current viral vaccines are produced and describe the…

A: A coronavirus is a type of virus belonging to the family Coronaviridae. Coronaviruses are named for…

Q: 5-5 5-5 5-s Nooo Insulin S-S s-s 5-s Meter Netel (2) 3 PPPP Herefeltet 4 Glucose (5) GLU

A: Insulin is a kind of peptide hormone which is produced by the Beta cells of islets of langarhans in…

Q: 4. What is ATP? 5. Diagram the ATP Cycle and label all of the parts. 6. What is an enzyme? 7. Define…

A: ATP, or adenosine triphosphate, is a crucial molecule found in all living cells. It serves as the…

Q: You are planning a party for a group of friends. Which of the following foods can you serve to…

A: Celiac disease is an autoimmune disorder characterized by an intolerance to gluten. Gluten is a…

Q: Lactic acid is an example of a common fermentation product. Fermentation is reduced by electrons…

A: Through a process called fermentation, carbohydrates are changed into new products by microorganisms…

Q: What are the layers formed in FECT and rationale behind the formation of these layers?

A: Formalin-ether sedimentation also known as FECT is a commonly used technique in parasitology to…

Q: Write in a unique derived trait for: A1: strepsirrhines (lemur/loris/potto/bushbaby) A2: tarsiers…

A: A complicated and intriguing subject that spans millions of years is the evolution of monkeys.…

Q: You measure your patient's fasting blood glucose 5 times in 30 minutes on a small glucometer. You…

A: Blood glucose concentration is regulated by the activity of two pancreatic hormones that are insulin…

Q: What is the role of potassium acetate in RNA extraction?

A: RNA extraction is a fundamental process in molecular biology that involves isolating RNA molecules…

Q: In several species of bacteria, GAPDH activity is controlled by the NADH/NAD+ ratio. Does the…

A: GAPDH is an enzyme that catalyzes the sixth step of glycolysis, which converts glyceraldehyde…

Q: Species C: ATGTTCGCCGACCGCTGACTATTCTCTACAAACCACAAAGATATTGGAACACTATACCTA…

A: By submitting your query sequence to the chosen database, do a BLASTn search. By comparing your…

Q: 1. Plate count data are used to calculate microbial population density as colony forming units…

A: Serial dilution is the method to calculate the micro-organisms in the sample. In this method, the…

Q: If you had to advise a farmer about what light level is best for growing potatoes, which light level…

A: For all ecosystems, sunlight is the primary energy source. It is captured and used by some bacteria…

Q: How does ninhydrin chemically react with histidine in a ninhydrin test? How does pH affect this…

A: Ninhydrin test is a chemical test to analyse, if a given analyte has amines or α amino acids. The…

Q: Diagram letter A B с mok D Endocrine gland involved A B C D Hormone involved gland Dis Name of the…

A: Many organ-like structures referred to as glands make up the endocrine system. The body has glands…

Q: Briefly discuss how the following may determine the type of statistical analysis to be applied in…

A: An empirical study is a type of research that is based on empirical evidence gathered through…

Q: Frankia isolate EAN1pec respires acetate, but will not grow on acetate as a sole carbon and energy…

A: Numerous microbes can use acetate as a common carbon source and energy source. However, some Frankia…

Q: the topic: tuberculosis 1. Introduction. It should summarize the next detailed treated topics. (No…

A: Tuberculosis (TB) is a global infectious disease caused by the bacterium Mycobacterium tuberculosis.…

Q: If the primary producer trophic level contains 792kg of plant material, how many kg of biomass can…

A: To estimate the biomass supported at the primary consumer or herbivore trophic level, we can apply…

Q: Conduct research online concerning recent advances in gene technology. Discuss two of these recent…

A: Recent advances in gene technology have brought about significant breakthroughs in the field of…

Q: 3. Chemical X inserts channels into bacterial cell membranes. Rhodospirillium, a purple non-sulfur…

A: Photosynthesis is a pathway by which all plants and some bacteria produce energy by utilizing carbon…

Q: Activation of M-Cdks requires the activity of _____. a. cyclin b. phophatase c.all of the above…

A: A critical stage in the advancement of the cell cycle is the activation of M-Cdks (mitotic…

Q: You are required to design a carbon-based, eukaryotic, unicellular organism that contains…

A: A unicellular eukaryotic cell is the most basic form of eukaryotic life. Unicellular eukaryotic…

Q: Paramecium caudatum is a unicellular organism that can phagocytose and digest a bacterium using…

A: A cell organelle is a specialized structure within a cell that performs specific functions necessary…

Q: i. Explain the behaviour of the amino acids (Alanine, Lysine, aspartic acid) during the ion exchange…

A: In column chromatography the elution process involves passing a sample through a column packed with…

Q: pre - weaning performance of piglets while the sow requires consideration of growth, morbidity and…

A: Pre-weaning The term "pre-weaning" refers to the period in the animal's life before it is fully…

Q: Suppose a positive Barfoed's test was obtained with sucrose solution suggest and 1-3 sentence…

A: Sucrose is a disaccharide. It is formed from the dehydration reaction of glucose and fructose…

Q: Stanley would like to compare the total fat contents of packaged hotdogs. He should read the…

A: Understanding the fat content of food products is critical since dietary fat affects our general…

Q: Gastric juice acidity is increased in a patient. Answer the questions A and B: A) How and why will…

A: Gastric juice refers to the acidic fluid secreted by the gastric glands in the stomach. It plays a…

Q: Review the Valenti, Vandenberg, and Lehman articles in this week's Readings and Resources and answer…

A: We must examine some parallels and differences between protein sources from plants and animals. We…

Q: 5. A DNA sequence of "ACG" will code for the amino acid First mRNA base (5' end of codon) U G UUU…

A: A codon is a sequence of three nucleotides in a messenger RNA (mRNA) molecule that specifies the…

Q: Please list the social impact caused by Coronavirus disease (COVID-19)

A: Coronavirus diseaseIt is commonly known as COVID-19. It refers to the infectious illness caused by…

Q: Choose from the image , Match each definition term to one descriptor. a. archaeological record b.…

A: The archaeological record refers to the collection of physical remains, artifacts, structures, and…

Q: During which stage of mitosis is DNA replicated. Use complete sentences for full credit. 4. During…

A: The cell cycle is a sequence of events involving the growth of cells and the division of cells that…

Q: Which of the following elements is NOT essential (a.k.a., macronutrients) for all bacteria?

A: An unicellular microorganisms which have cell wall, dose not have organells and organized nucleus is…

Q: A. Describe in complete sentences how the requirement of a PAM sequence affects the flexibility of…

A: To make specific changes in organism's DNA scientific found a method, this method is known as gene…

Q: How does age, heredity,food, and environment affect wellness?

A: Through nutrition, food immediately affects your health. Additionally, it is indirectly related to…

Q: Choose the process that does NOT produce ATP O Fermentation Aerobic respiration Anaerobic…

A: ATP stands for adenosine triphosphate. It is a molecule found in all living cells and serves as the…

Q: Researchers who study those rods cells have performed a series of experiments to better understand…

A: The phototransduction pathway is the process in which the photons are converted to electrical…

Q: (b) In a batch bioreactor, the growth of a microbial population is often limited by the availability…

A: As the question contain two different questions, here we have only solved the second one. Bacteria…

Q: Give only typing answer with explanation and conclusion For the genotype shown below, which best…

A: Operon is the prokaryotic gene regulatory system or mechanism that regulates the expression of…

Q: Dichotomous key construction. Create a dichotomous key using the genera/species and characteristics…

A: Dichotomous KeysA dichotomous key is a tool that allows the user to determine the identity of items…

Q: Consider why there might be natural selection for poisonous plants to warn potential herbivores with…

A: In plants the above-ground structures such as leaves and flowers are vital for photosynthesis and…

Q: how does the peripheral nervous system regulate homeostasis

A: Nervous System is the prime controller of homeostasis and provide quick responses in maintaining…

Q: 1. Paramecium caudatum is a unicellular organism that can phagocytose and digest a bacterium using…

A: Within the unicellular living being Paramecium caudatum, hydrolytic enzymes are utilized during the…

Q: What is/are the product(s) of the light capturing reactions of photosynthesis? a) ATP and NAD(P)H b)…

A: Photosynthesis is a phenomenon in which the light energy in converted to chemical energy. This…

Q: I'm doing my project on CO2, one of the prompts is "Describe the usage including relevant energy…

A: Carbon dioxide (CO2) is a colorless and odorless gas composed of one carbon atom bonded to two…

Concept explainers

Viral Infections

Viruses are abundantly found, minute entities that have genetic material enclosed within a protein coat. The proteinaceous material enclosing the genetic material of the virus is called a capsid. The genetic material could be either DNA (deoxyribonucleic acid) or RNA (ribonucleic acid). A virus is too minute to be looked at with naked eyes and therefore visualized with the help of a microscope. They are acellular entities that require a host for processes, such as replication, transcription, translation and multiplication. Plants, animals, and bacteria act as host wherein the virus reproduce. Viruses cannot multiply outside the host's body and thus are considered nonliving outside the host body.

Question

12:14
An edible vaccine has been created against
Select one:
O a. HIV, not approved
O b. HIV, approved
O C.
the swine flue, not approved
... 5
and is currently.
O d.
the plague which caused the Black Death, not approved
O e. the plague which caused the Black Death, approved
×
by the FDA.

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

SEE SOLUTION Check out a sample Q&A here

Step 1: Introduction

VIEW

Step 2: Edible vaccines

VIEW

Solution

VIEW

Step by step

Solved in 3 steps

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.

Similar questions

5.2 Describe how the use of HIV combination therapy has improved the wellbeing of infected patients.
1. Describe Sabin's Mission to Moscow and Sabin's efforts to prove to the world that his vaccine was better than anyone else's. 2. With the success of Salk's vaccine polio was on the decline. A. What were the number of cases reported in 1955 - 1957? B. What was the biggest challenge in conquering polio now? 3. What was Salk's plan for his future in Pittsburg? How did it turn out?
( Notes ... 1. Describe what class of virus SARS-CoV-2 belongs to and why. 2. Compare the terms SARS- CoV-2 and COVID-19. 3. Briefly describe the life cycle of the virus in mammalian cells, paying special attention to the role of RNA. 4. Describe the mechanism by which the Pfizer and Moderna vaccines work, paying special attention to the central dogma of biology. 5. Discuss what you have learned about the vaccines' efficacy and safety. 6. Share any concerns you have either about the vaccine itself or about public perception and acceptance of the vaccine.
Plz answer and Do explain. 31. HIV is an enveloped virus. As a result... a. it is extremely hardy and is very difficult to control on famites. b. It is more resistant to antimicrobials than non-enveloped viruses. c. it sticks to the medical instruments, d. it is insensitive to high heat. e it can be controlled easily with 10% bleach solution.
Which of the following is an autoimmune disease of the heart? rheumatoid arthritis lupus rheumatic fever Hashimotos thyroiditis
What is the most abundant antibody class detected in the serum upon reexposure to a pathogen or in reaction to a vaccine? a. IgM b. IgA c. IgG d. IgE
1- There is no vaccine for this cause of viral hepatitis: A. Hepatitis A B. Hepatitis B C. Hepatitis C type of viral hepatitis D. Actually there is no vaccine for any 2- The same virus causes both of these diseases: A. measles and chickenpox B. influenza and warts C. influenza and bacterial pneumonia D. shingles and chickenpox 3- Herpesviruses are a family of viruses that all cause infections. A. latent B. sexually-transmitted C. fatal D rabies 4- Pelvic inflammatory disease (PID) in women is a possible consequence if this disease (or diseases) is not treated: A. gonorrhea B. chlamydia C. both A&B D. neither A nor B 5- Health care workers know they need to wash their hands before and after patient contact In some cases, hand sanitizer is an acceptable way to clean the hands. However, hand sanitızer is NOT acceptable if the patient has A. Clostridium difficile B. strep throat C. the flu D. dementia 7- How is Hepatitis C virus most commonly transmitted? A. in food vaccines B. from mother…
7 Based on the experience of the Philippines with the dengue vaccine, what can you conclude regarding the Dengvaxia Case? a. Due to some reasons such as corruption and cost cutting., the implementers neglected to conduct zero-testing of the children for vaccination. b. All vaccines are not safe to use. They give harmful side effects to any individuals and thus should not be given to anyone especially new born babies. c. Dengvaxia vaccine is a dangerous vaccine and should not have been given to anyone in any country. d. Dengvaxia was in its premature stage (trial stage) when the government accepted the vaccine to be tested to school children in 2015 while other countries started vaccination on 2016-2017. e. The pharmaceutical company may have missed telling the Philippine government about the adverse effect of the vaccine to individuals who never had dengue fever before vaccination.
6. Name the Vaccine Preventable Diseases.
6) (2 pts) Describe one way your INNATE IMMUNE SYSTEM can help fight viral infections while it waits for the acquired system to show up.
27. After experiencing recurrent bacterial infections, you diagnose your patient, Mrs. Watts, with non immune mediated neutropenia. So which of the following would you prescribe to treat her condition (the bacterial infection)? (Please note: she is in generally good health and please think about the possible side effects of your medications.) a. tetracycline - antibiotic colors teeth b. streptomycin c. staphylococcal enterotoxin B d. cyclosporine e. diflucan not ble antifungal # 28. Which of the following diuretics would you NOT prescribe by mouth? a. Spironolactone you can b. Lasix Aq | | 1 12 c. Microzide dMannitol - decrease ICP, e. Methazolamide 29. Your patient has been experiencing nocturnal enuresis (bedwetting). So therefore, which of the following drugs/products would you give him/her to help prevent the nocturnal enuresis? (Hint: ADH) a. aspirin b. methocinnamox c. foscarnet d. lithium mental issues e. beer tarken by ICP, taken by IV, don't m a. low potassium levels b. high…
1. What is Corona Virus Disease 2019 (COVID 19)? What is the cause of it and how it transmit to a people?