Answered: Assess the general relationship of the…

Assess the general relationship of the fish condition, temperature, and onset of rigor mortis. Explain in not more than 100 words.

Basic Clinical Laboratory Techniques 6E

6th Edition

ISBN:9781133893943

Author:ESTRIDGE

Publisher:ESTRIDGE

Chapter2: Basic Hematology

Section2.13: Erythrocyte Sedimentation Rate

Problem 3RQ

See similar textbooks

Related questions

Q: 3. Albinism is a recessive trait. Determine the genotypes of the parents and offspring. a. A normal…

A: Albinism is a autosomal recessive disorder. To express this disease two recessive alleles are…

Q: 9. The water in warmer streams possess d. Feed the beans to the chickens, wait for the chickens to…

A: C. More ,less,more

Q: Using ALL of these terms: antigen antibodies plasma erythrocvte please describe WHY a person with B-…

A: B blood group has antigen B(agglutinin) and antibody anti-a ( agglutinogen) . AB blood group has…

Q: B. One strand of a section of DNA isolated from E. coli reads: (Assume no start codon is required as…

A: ANSWERS Template -----> 5' GTAGCCTACCCATAGG 3' 1. Ans ) Complementary Strand ----->…

Q: Oxygen's function is limited to the last phase of aerobic respiration. Describe the significance of…

A: Introduction Through the electron transport chain (ETC), an important component of cellular…

Q: What is the importance of feedback systems in the control of hormonal output in mammals? Offer two…

A: A feedback mechanism is a loop in which a product feeds back to control its own production.

Q: Determine what is the most likely mode of inheritance of this disease (whether it is inherited as…

A: Inheritance pattern is a pattern tat evaluates how traits are transmitted from parent generation to…

Q: SUBJECT- GENETICS Topic: The blood group in humans Question: Do some computation for the possible…

A: Introduction :- Blood types are determined by the presence or absence of antibodies and hereditary…

Q: Which of the following narcotics resembles erotonin? Mouse Party O Heroin O Methamphetamines Ectasy…

A: Narcotics Narcotics are the chemical compounds or substances that improve mood and helo in treating…

Q: The diagram on the right has been drawn to scale. The width of the cell has been drawn at 5 cm. What…

A: Cells have different sizes, shapes, and structures. The sizes are usually measured in units like…

Q: To determine: The three classes of the amino acids which are likely to be important for the…

A: Proteins are usually defined that they are about to refer as they are necessary for the human body…

Q: Label the parts of the frog

A: Introduction A frog is any member of the order Anura, which consists of a diverse and primarily…

Q: 5’ UGG CAA UCC UAC GAU 3’ Write out the sequence of the anticodon in the tRNA that would bind to…

A: In molecular biology, messenger ribonucleic acid is a single-stranded RNA molecule that corresponds…

Q: Select the correct statement about cardiac output. A slow heart rate increases end diastolic…

A: Introduction Cardiac output is calculated by multiplying the stroke volume by the heart rate. The…

Q: The Ro of Ebola has been estimated to be somewhere between 1.5 and 2. See graphic below. The number…

A: Transmission of Ebola virus to new continent.

Q: 2 -3 Which cranial nerve innervates the eye muscle labeled 2 in this diagram?

A: Introduction: Six cranial nerves innervate in eyes.motor, autonomic and sensory. The muscles…

Q: Which statement best describes a characteristic of ALL arteries? Select one: O a. Arteries lead…

A: Introduction Blood vessels are tubes that transport blood throughout the body. They form a…

Q: explain: The kelch repeat domain in the problem in-line" or "plug-in" type domain.

A: Protein is a type of biomolecule. It is made up of a polypeptide chain, which is a chain of amino…

Q: When the body is exposed to the same virus a second time, the immune response is Accompanied by…

A: Any foreign substances or pathogen can be harmful to an organism. Hence, the organism will develop…

Q: A population of wolves in a national park is known to be 150 individuals. As wildlife ecologist, you…

A: Ecosystem balance, often known as "ecosystem homeostasis," is influenced by both factors that tend…

Q: Can you please tell me all the parts in the picture? Please just label them clearly thank you.

A: Cell structure is different in both prokaryotes and eukaryotes.

Q: The structure of DNA requires both hydrogen bonds and phosphodiester bonds Explain the connection…

A: Phosphodiester bonds are the backbone of nucleic acids. A phosphodiester bond is formed when two…

Q: The role of biology in sexual orientation is still unclear. Examine the literature on sexual…

A: The connection between biology and sexual orientation is being studied. While scientists are unsure…

Q: Achondroplasia, which is characterized by difficulty converting cartilage to bone and thus results…

A: Hhsbanf is colorblind i.e XcY Wife is carrier as their son and daughter both are affected .i.e XCX…

Q: current themes in depression

A: Depression Depression is defined as a state of mind where the mood is not happy. It causes a lack of…

Q: To determine: The reason due to which scientists think that new genes arise by the duplication of an…

A: The basic structure and functional unit of heredity is the gene.Thus, a gene is a fundamental unit…

Q: fish die-off occurs in a pond near an agricultural field where fertilizer high in N and P has been…

A: Nitrogen, phosphorus and potassium, or NPK, are the 3 essential supplements in commercial…

Q: To describe: The competitive and noncompetitive inhibitors and also describe the way in which they…

A: Inhibitors are molecules that prevent enzymes and substrates from binding together. Inhibitors work…

Q: Please EXPLAIN the key difference(s) between Segregation (as described by Mendel) and Independent…

A: Mendelian inheritance was a type of biological inheritance was given in 1865 by great scientist…

Q: Give two reasons why a point mutation in the codon for methionine (Met) would likely be more serious…

A: Point mutation is a mutation where a single nucleotide is changed i.e. insertion, deletion or…

Q: Which of the following statements about bone marrow is CORRECT? yellow marrow is responsible for…

A: Bone marrow is the soft spongy tissue which contains blood vascle, found in centre of the bones.…

Q: Please DEFINE the following terms, and explain how they apply to Andean Condors: Homogametic sex…

A: Andean condor It is a bird of South America bird. It belongs to the family Cathartidae. It is the…

Q: Citing the data from your results table tell which antibiotic is the most effective against this…

A: Antibiotic Sensitivity Test is a test used to evaluate to efficacy of particular antibiotic in…

Q: Gene flow can have one effect in the context of a single population, and a different effect in the…

A: Gene flow is the movement of genes or alleles between populations separated by geography. The…

Q: Provides support and nutrition to neurons, as well as influences nociception. Cellulose Myelin…

A: Glial cells is a common term used for many types of cells like astrocytes, microglial, Schwann…

Q: How Do Species Form in Hawaii’s “Natural Laboratory” of Evolution?

A: Introduction A species is typically defined as a collection of organisms that can reproduce…

Q: Zone of inhibition for each antibiotic Trial 1 Trial 2 Trial 3 Average Sample A (mm) 22 21 21 21.3…

A: Disc diffusion method ( Kirby bauer method ) is a method for determining the sensitivity or…

Q: Which of the following is false regarding the gills of fish? O They utilize countercurrent exchange…

A: Apparently gills of fish :- utilize countercurrent exchange to maximize the oxygen uptake. have high…

Q: Insulin-like growth factor 2 (IGF2) is located on chromosome 11. My maternal copy of chromosome 11…

A: The IGF2 gene provides instructions for making a protein called insulin-like growth factor 2. It…

Q: 2. In your own words, describe two different reasons why a eukaryotic cell may need to control gene…

A: gene expression is a process to regulate the production of active gene to produce the proteins to…

Q: Question 5 To identify genes associated with the movement disorder Parkinson's disease, you decide…

A: Inorder to amplify a double stranded DNA via PCR, we require 2 sets of primer; a forward primer and…

Q: Q1/Answer the following: 1. Describe the digestion of proteins by pancreatic enzymes? 2. Write the…

A: 1) Pancreatic proteases: Trypsin and chymotrypsin are endopeptidase type of enzymes. They…

Q: A. For each of the following nucleotide sequences, determine the amino acid sequence. 1. 5'…

A: Introduction Amino acids are molecules that combine to form proteins, They build muscles, prevents…

Q: f the lophophore is absent in brachiopods, would you consider them to be members of Mollusca? Why or…

A: Definition: - A lophophore creates a continuous, laminar water flow, induced by the lateral cilia on…

Q: You are a Biology, what are the benefits of having an entrepreneurial mind set

A: Bio-business venture is an academy controlled business as it is driven by science based advancement.

Q: What defines each level of the biological hierarchy of organization

A: Taxonomical hierarchy can be defined as the process of arranging organisms on the basis of their…

Q: S-TAGTAGGOOGCATOTTTTCCCATACAGATGAAGGATAAACTCGTCTXTAT-3 [x]-cleavage site for CFICFII endonuclease…

A: DNA ( Deoxyribonucleic acid ) is two stranded , ladder like helical structure that functions as…

Q: Explain how these polymers are digested and how the products of digestion are used in the human…

A: Large insoluble food molecules are broken down into little water-soluble food molecules during…

Q: Refer to the description and table below to answer the three question that follow: Dissolved oxygen…

A: Net primary productivity of the algae.

Q: Adaptive radiation

A: Evolution evolution is a process by which organisms adapt and grow to serve better in their natural…

Question

Assess the general relationship of the fish condition, temperature, and onset
of rigor mortis. Explain in not more than 100 words.

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

SEE SOLUTION Check out a sample Q&A here

Introduction

VIEW

Solution

VIEW

Step by step

Solved in 2 steps

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.

Similar questions

give the steps for frog disection
Name and explain: Name the crustacean and other animals that have moult inhibiting hormone (MIH). Explain the way to collect the hormone.
Complete the table regarding the comparison of the vertebratedigestive system. PLEASE Write the keywords only.
Describe how urine is formed and excreted in frogs. Include in the discussion the structures involved in the process.
Complete the missing body temperatures for turtles. And answer questions 3 and 4
Desscribe how a physoclistous fish increases the amount of gas in its swim bladder. Please the important anatomy, physiology processes, and chemistry. (please keep it under 4 sentence)
Please answer number 4 for: "Pacific Cownose Ray"
Check all that applies: The macula densa ... form the parietal layer of the Bowman's capsule form the visceral layer of the Bowman's capsule is part of the juxtaglomerular apparatus are modified epithelial cells of the DCTS Oare involved in the glomerular blood filtration system are macrophages unique to the urinary system
Describe the following figure in as much detail as possible. Start with overall fırst.
Briefly explain these three facts:
ID this fish:
Give typing answer with explanation and conclusion A 34-year-old man comes to the physician because of a 1-week history of temperatures to 39°C (102.2°F) and pain with urination. Physical examination shows generalized abdominal tenderness and right flank tenderness. Active extension of the right hip produces right flank pain. Urinalysis shows 100 WBC/hpf. Irritation of which of the following structures is the most likely cause of this patient's pain on hip extension? A) External iliac artery B) Femoral nerve C) Genitofemoral nerve D) Piriformis muscle E) Psoas muscle F) testicular artery