Assume x goes to $s0, y goes to $s1, and the address of the first element in the array A goes to $s2. Convert the following C code to MIPS. Use temporary registers ($t0, $t1, etc.) when appropriate. A[1] = y;
Q: What are the benefits of eliminating data redundancy?
A: The question is about the data redundancy in the database and why we try to eliminate it.
Q: 14. Use Gauss-Jordan elimination to solve the following linear system: -3x + 4y = -6 5x - у%3D 10 O ...
A: Here in this question, we have given some linear equations and using gauss Jordan elimination metho...
Q: Exercises: 1. Copy and Run the code. 2. Solve the system of equation and grapg the system in 2-varia...
A: ANSWER:-
Q: OR A. A. B. OR (a, buy) Follow the same steps, but use the gates, and each gate has its own table fo...
A: AND, OR, NOT are the basic gates, NOR, NAND are the universal gates. XOR gate is the special gate. ...
Q: . Java is known to be an object oriented program. Objects are also known to exist in real life. You ...
A: A real-world entity such as a pen, chair, table, computer, watch, and so on is referred to as an obj...
Q: Comparing Computing Models Determine whether the gate set {MAJ, XOR, 1} is equivalent to {AND, OR, N...
A: YES the gate set ,{MAJ,XOR,1} is equivalent to {AND,OR,NOT} Because the truth tables are the same fo...
Q: Using C#, design a multithread and demonstrate foreground and background threads.
A: Using C#, design a multithread and demonstrate foreground and background threads.
Q: Write a logic statement that corresponds with the given logic circuits:
A: Given logic circuit contains three input variables A, B and C and one output variables X. This circu...
Q: Write a program that includes the following while loops and LABEL EACH LINE OF THE LOOP WITH A COMME...
A: package com.company;import java.util.Scanner;public class Circle { public static void main(String[...
Q: When it comes to a comprehensive 5G infrastructure, what are the projected benefits, and how are the...
A: 5G wireless technology is used to deliver ultra speed data network, increased availability and more ...
Q: java When we create an object of a class, the object's instance variables are automatically initial...
A: When we create a object of a class then it calls the default constructor automatically and that defa...
Q: The following cipher text is obtained using a rail-fence method with 4 rails. What is the plaintext?...
A: answer is
Q: Define test variable
A: Introduction: A test variable is a user-defined name-value pair that saves and refers to information...
Q: java Which of the following code constructions is an example of a sequence? Choose an alternative:...
A: A set of instructions performed in a particular order is known as a sequence. Instruction 1 is perfo...
Q: Is it necessary to include control pins of the bus arbitration type in a microprocessor in order to ...
A: Bus arbitration The process of selecting the next device to become the bus master and transferring ...
Q: * There are two notation to represent real numbers in C++ floating Decimal notation O Exponential no...
A: The answer of this question is as follows:
Q: An illustration of a super type/subtype connection. Where does the disjoint rule come into play?
A: Disjoint sets of entities are required for sub-classes under the disjoint rule. The overlap rule req...
Q: Make a decision on the type of wireless local area network connectivity that will be utilized.
A: Introduction: A communications network that connects wireless devices in a certain region. Wi-Fi is ...
Q: (Java) The Sculpture Subclass Write class as follows: The class is named Sculpture, and it inherits ...
A: ALGORITHM:- 1. Create class Painting. 2. Create class Sculpture inheriting the Painting class. 3. Cr...
Q: Build a form to get follo
A: <html> <head> <style> div { box-sizing: bo...
Q: 3 Proof Prove or disprove that the context-free languages are closed over the reverse operator, i.e....
A: We want to show that if L is a context-free language, then LR is a context-free language. So let G b...
Q: Exercises: 1. Copy and Run the code. 2. Solve the system of equation and grapg the system in 2-varia...
A: ANSWER:-
Q: Match expression (exprN) with code! expr1 for (; expr2; expr3) expr4 expr1: Answer 1 expr2: Ans...
A: The syntax in the given question is using a for loop.
Q: There are two computers, each one has CPU A and CPU B respectively, which are running the same Progr...
A: Answer: Given computer1 number of CPU clock cycle is 500 for computer 2 instruction count 300 and ...
Q: Is there an usual connection between an untrusted network, a firewall, and a trustworthy network, an...
A: Introduction: Because of robust firewalls, computers on trusted networks are safer and more secret. ...
Q: 3-Write a program in c language to Prints the string of your name to the serial monitor using Arduin...
A: *As per the company norms and guidelines we are providing first question answer only please repost r...
Q: Describe the SBB instruction in further detail.
A: Given: Describe the SBB instruction in further detail.
Q: Write a complete C++ program that 1) Prompts the user to enter from the keyboard two numbers of type...
A: I give the code in c++ along with output and code screenshot
Q: Which of the following is the most accurate definition of Software Engineering? O Top-level decompos...
A: According to the information given:- We have to choose the correct option is to satisfy the statemen...
Q: Given the function F(X,Y,Z) = X’Y’Z’ + X’YZ’ + XY’Z + XYZ : Draw the logic diagram using the ori...
A: To draw the logic diagram using the original Boolean expression.
Q: Based on history of agile software development the plan- driven software approach has been developed...
A: Agile Software Development: The main goal is Rapid value and responding to change. Environment - Goo...
Q: Make a list of six different access technologies. Each one should be classified as either home acces...
A: Introduction : There are six different types of access technologies: Dial-up modem: 56kbps maximum t...
Q: can anybody tell me what the meaning and (((draw )))) partial key of the weak entity type? if you...
A: In their identifying link with the owner identification, the weak entities face a whole participatio...
Q: Given a transmission rate of 1 Gbps and a propagation speed of 200m / μ sec , how many meters of ca...
A: Transmission Rate = 1 Gbps = 109 bits per second Propagation Speed = 200 metre / micro second = 200 ...
Q: Microcontroller (PIC16F877A) : If program will not reach that point write “unknown”. A = 0000 0000...
A: Here, I have to provide an explanation to the above question.
Q: You are tasked to implement an abstract data type class which takes in a given input file called inp...
A: import java.io.BufferedReader;import java.io.DataInputStream;import java.io.FileInputStream;import j...
Q: Find the Histogram and Negative of the following 8-bits Image
A:
Q: Q4. For the system with state as given below using resource allocation graph, find out if there is a...
A: Resource Allocation Graph: Deadlock is present. Deadlock: P0 requires 3 which is allotted to P1, P1...
Q: True or False. In time dilation, is the time recorded on the moving clock related to the time that ...
A: Time Dilation is a concept or we can say real as from Einstein's experiments. It is a phenomenon whe...
Q: Write a java procedure that implements the more-efficient binary search algorithm a) test that x = “...
A: I give the code in Java along with output and code screenshot
Q: e a JAVA program to calculate percentage of a student for 3 different subjects. Create an exception ...
A: Solution:-
Q: Describe the client/server architecture, including tiers, cost-benefit analysis, and performance.
A: Introduction: Architecture of the client/serverClient/Server Architecture is a term that refers to s...
Q: A constructor is a special method that has the same name as the class and the return type void. Cho...
A: Constructor :- Actually , A constructor is a special type of member function that is called automat...
Q: convert into c++ program
A: For converting python program to c++ we need to declare variables before using them. we can use prin...
Q: java There is only one type of constructor and it is a constructor that does not take any parameter...
A: Java Constructor are a methods that get invoked whenever we call the class for which the constructor...
Q: Assume you have a customer who has never utilized a network before. Explain the functions of network...
A: Explanation: Client/Server Model The server is a provider, and the client makes use of the server'...
Q: Write a checkbook balancing pr-
A: According to the question, we have to assign a task to write a program in C++ . And this C++ program...
Q: FF)
A: given - Programming using Assembly language / 80861) Write a program to print your first name (use d...
Q: Define the characteristics that are required for test-driven development. In the event that you wish...
A: According to the query key principles of test-driven improvement TDD, and presuming that you are lig...
Q: When a bit in an operand is shifted to the left, which instruction copies the highest bit into both ...
A: Introduction : The right shift operator moves a number's bits to the right in its binary form. It is...
Assume x goes to $s0, y goes to $s1, and the address of the first element in the array A goes to $s2. Convert the following C code to MIPS. Use temporary registers ($t0, $t1, etc.) when appropriate.
A[1] = y;
Trending now
This is a popular solution!
Step by step
Solved in 2 steps
- a C++ program that creates a two-dimensional integer array (4x3) initialized with user given data. The program should have the following functions: • Print the sum of all values in the array. • Print the average of all the values in the array. • Take row number from user and print the sum of the values in that specified row.(use loop and no if statement) • Take column number from user and print the sum of the values in that specified column.(use loop and no if statement)Language: C Write a program that will allocate memory to an array of the size specified by the user at runtime. Use malloc and free. Fill the array, print the elements and calculate the average value. A. In the main function: a) Ask the user for the size of the array. b) Using the malloc function allocate the double array of the size specified by the user. c) Check if the allocation was successful. - If the address returned by malloc is not NULL, use the rand function in a for loop and assign pseudorandom values to the array elements. Then call the function averagevalue. Print the result. Free up memory with the free function. - If the allocation failed and the address returned by malloc is NULL, print the message and exit the program. B. Define the function averagevalue and then call it in main. The function calculates the average value of the elements of the array passed as an argument and prints the array elements to the screen. The function returns the average value. C. Use…Machine Problem: Create a C-program using one dimensional array that will display the output below. The program should have a function that will insert the element entered by the user to the desired index position and display the array elements after inserting the new element. The program should run and must produce an output like the sample photos
- MIPS Assembly The program: Write a function in MIPS assembly that takes an array of integers and finds local minimum points. i.e., points that if the input entry is smaller than both adjacent entries. The output is an array of the same size of the input array. The output point is 1 if the corresponding input entry is a relative minimum, otherwise 0. (You should ignore the output array's boundary items, set to 0.) My code: # (Note: The first/last entry of the output array is always 0# since it's ignored, never be a local minimum.)# $a0: The base address of the input array# $a1: The base address of the output array with local minimum points# $a2: Size of arrayfind_local_minima:############################ Part 2: your code begins here ###la $t1, ($t2)la $t1, ($t2)move $a1, $s0 li $a2, 4jal find_local_minima print:ble $a2, 0, exitlw $a0, ($s0)li $v0, 1syscall addi $s0, $s0, 4addi $a2, $a2, -1 ############################ Part 2: your code ends here ###jr $ra I am not getting the correct…Write a C code that finds the numbers of the Fibonacci sequence in a sequence entered by the user. Note that dynamic memory functions must be used if arrays are to be used.C++ Code: This function will print out the information that has been previously read (using the function readData) in a format that aligns an individual's STR counts along a column. For example, the output for the above input will be: name Alice Bob Charlie ---------------------------------------- AGAT 5 3 6 AATG 2 7 1 TATC 8 4 5 This output uses text manipulators to left-align each name and counts within 10 characters. The row of dashes is set to 40 characters. /** * Computes the longest consecutive occurrences of several STRs in a DNA sequence * * @param sequence a DNA sequence of an individual * @param nameSTRs the STRs (eg. AGAT, AATG, TATC) * @returns the count of the longest consecutive occurrences of each STR in nameSTRs **/ vector<int> getSTRcounts(string& sequence, vector<string>& nameSTRs) For example, if the sequence is AACCCTGCGCGCGCGCGATCTATCTATCTATCTATCCAGCATTAGCTAGCATCAAGATAGATAGATGAATTTCGAAATGAATGAATGAATGAATGAATGAATG and the vector namesSTRs is…
- 6. Comment on each snippet with what the snippet does. Assume that there is an array, int arr [6] = (3, 1, 4, 1, 5, 9}, which starts at memory address 0xBFFFFF00. You may assume that each integer is stored in 4 bytes. Register a0 contains arr's address 0xBFFFFF00. a) b) 1w 1w add SW loop: end: to, 0 (a0) t1, 8 (20) t2, to, t1 t2, 4 (a0) add slti beq slli add 1w sub SW addi j to, x0, x0 t1, to, 6 t1, x0, end t2, to, 2 t3, a0, t2 t4, 0 (t3) t4, x0, t4 t4, 0 (t3) to, to, 1 loopC Programming Not C++, pls a)Write a main function that declares an array of 10 int’s. Assign each element in the array a value between 1 and 100 using 10 assignment statements – just make up the values. Write a for loop that will printout each of the elements in the array. b)Start from scratch on each of the parts. Write a main function that declares an array of 100 doubles.In a for loop, assign each of the doubles a random number between 0.50 and 50.00. Here’s how.array[i] = (double) (rand() % 100 + 1) / 2.0;Output the elements of the array in 10 columns that are each 6 spaces wide. Each row in the output will have 10 values. The doubles will be printed with 2 places of accuracy past the decimal.The output of this one-dimensional array requires a single loop with an if statement inside. Even though the 100 numbers are going to be presented as a table of numbers, they are still just a list in memory. c)Write a main function that declares an array of 100 ints. Fill the array with…Write the C programming function that prints a 23 numbered array sent into it with the main function.(Please generate the 23 numbers randomly)
- Using C++: Write a program that creates a 5 by 5, two-dimensional array that store 25 integers and the program will call five functions. Function display(): the program will display all the integers (in the 5 by 5 format) Function calculateTotal(): the program will return the total of the 25 integers Function totalRow(): returns and displays a 5-element array with each of the element showing the total of all the elements of the same row in the 5 by 5 array. Function totalColumn(): returns and displays a 5-element array with each of the element showing the total of all the elements of the same column in the 5 by 5 array Function maximum(): returns the largest value in the 5 by 5 arrayWrite C++ statements to do the following:i.Declare an empty array DATA to hold 7 double floating values.ii.Assign value 5.7 to the last element in the array.iii.Display the sum of the first two elements without using extra memory variable.iv.Write a while-loop that computes the sum of all elements in the array.v.Write a while-loop that finds the minimum element in the array.vi.Randomly generate an index and display the element at this (randomly generated) index in the array.vii.Use an array initializer to declare another array with initial values 5.78, 12.69, 10.45, and19.0C language for solution Note: soution this program Use Array 1. Write a program to do the following: a. Write a Cover Page function to print the HW details passing the needed parameters and has no return. b. Write a function that gets student grades and ID (maximum number of students is 20) then the function has a switch statement to enable the user to choose one of the following operation: i. Call MaxMin function to find and print the maximum and minimum grades as well as their ID ii. Call function Average to return the average grade of the class. iii. Call mark function to print students ID, their grades, and marks (as in the below table) iv. Call Sort function to sort the student ascending or descending based on their grades. The program will repeat the operation tile the user wish to terminate the program. Note: Student's grades are between 0 and 100 (use data validation technique). • You will get zero if you don't use comments and print HW details (your name, course name, course…