Assuming you have determined the sequence of a certain enzyme/protein product, how will you identify its correct DNA sequence? (*some codons are redundant or wobbled using the DNA library.)
Q: Explain how an enzyme is able to catalyze the synthesis of a large molecule from two smaller…
A: An enzyme is able to catalyze the synthesis of a large molecule from two smaller molecules have to…
Q: A protein that has lost its tertiary structure and is non- functional is called den
A: We know that Proteins are basically polymers that are made up of monomers called amino acids. There…
Q: Which of the following is a reactive oxygen species that can damage proteins? Select one: a. vitamin…
A: b. superoxide is a reactive oxygen species that can damage proteins. As you can see only…
Q: What is the flow of the Urinary system and why is it important?
A: The urinary or renal system is one of the organ systems that helps to remove waste from the human…
Q: A study is conducted to see if the presence of physical recreation related infrastructure (e.g.…
A: Study design It refers to the framework, procedures, and methods that are used to collect and…
Q: Discuss amongst yourselves the ethical principles at stake when faced with a moral dilemma and the…
A: HIPPA Law: HIPPA law is an act that is referred as Health Insurance Portability and Accountability…
Q: A mutation in p21 that destroys its binding site will
A:
Q: Describe the functions of each of the three classes of T cells.
A: Introduction T cells T cells are also known as T lymphocytes. T cells originate in bone marrow and…
Q: Actin is found in Microtubules are found in Select one: a. microvilli and flagella, lamellipodium…
A: Cytoskeletons are protein filaments that are present in cytoplasm of cells and form intracellular…
Q: determine the distance of the genes
A: 4. B.) Generally, the testcross with highest number of offspring represent the phenotype and…
Q: DIHYBRID CROSS Heterozygous Yellow and heterozygous round seed crossed with homozygous yellow and…
A: Introduction An experiment where two organisms are mated and are both identically hybrid for two…
Q: 4. The following graphs show changes in blood sugar levels after eating. healthy type 2 diabetes…
A: Introduction Blood sugar, also known as blood glucose, rises over average when you have diabetes, a…
Q: Answer the following completely. 1. Discuss the general mechanisms by which the following…
A: The body has an immune system to protect against diseases. There is both innate and adaptive…
Q: Theme: Nutrition choose 5 health problems that are related to that theme. Only one person signed up…
A: The risk of developing associated morbidities or diseases, including hypertension, high blood…
Q: A tumor suppressor gene regulates the cell cycle; an example is
A: The tumor suppressor genes are anti-oncogenes that prevent the uncontrolled growth of the cells by…
Q: Should we try to save New Orleans or just give up and move the port at the mouth of the Mississippi…
A: New Orleans is a city in Louisiana. It is located on the river Mississippi.
Q: A communicable disease is... a disease that is easily spread from one host to another. a change in a…
A: Option 1. Injuries that transmit from one person to another, from an animal to a person, from a…
Q: Explain the reason why most proteins have less D-aspartate and elastin has increasing levels of D-…
A: Racemization is the process by which a pure mixture of enantiomers is completely transformed into a…
Q: 6. What is the most common clearing agent? What are the advantages and disadvantages of using this…
A: Applying chemistry to the research of biological activities at the molecular and cellular levels is…
Q: Blood clots form in response to __________________ which cause bleeding.
A: When blood transitions from a fluid to a semi solid state, blood clots, which resemble gel-like…
Q: Part II. Transcription as a Process 4. Use the below "transcription bubble model" of a gene during…
A: Introduction:- Transcription is defined as the process of RNA ( coding as well as non-coding RNA)…
Q: Scientists carried out a microarray analysis to compare the gene expression of normal pancreatic…
A: Scientists can use microarray analysis to compare the gene expression of normal cells to that of…
Q: Define the Several problems not applicable to synthetic drugs often influence the quality of herbal…
A: Herbal drugs have been used since ancient times. Herbal drugs are preparations made up of plant…
Q: Elaborately define the major considerations in dosage form design with example?
A: Drug substances are rarely administered alone; instead, they are combined with one or more…
Q: Which blood type (including +/-) would be considered a universal donor for blood transfusions? Why?
A: Please follow step 2 for detailed explanation.
Q: Aberrations in the cell cycle can directly result in___. Select one: a. Cancer b.
A: a) cancer
Q: Lysogeny is a form of viral replication is characterized by a viral prophage is when the virus…
A: Virus It refers to a microscopic pathogen that can replicate only inside a living cell of an…
Q: The genus Homo dates back to about ____. a. 3.9 million years ago b. 1.8 million years ago c.…
A: The biological and cultural development of humans is referred to as human evolution. Many fossil…
Q: Scientists uncover a new pathway for synthesis of Threonine (see below). They also identify mutants…
A: Mutants are those species that are different from wild type and they either lack or gain some…
Q: 1. Use the prokaryotic gene DNA sequence below to answer the following questions: 1 11 21 31…
A: The DNA sequence is replicated to produce daughter DNA which is the same as the parent DNA. Further,…
Q: "As development progresses, individual cells become more and more restricted in the range of cell…
A: The capacity of a cell to differentiate into one or more specific cell types is known as its…
Q: 3. You are trying to determine which, if any children (C1-C4) of a given mother (M) are fathered by…
A: “Since you have posted multiple questions, we will provide the solution only to the first question…
Q: Actin
A: Actin: It is defined as a protein which is important in the contractile property of the muscles and…
Q: Answer with more detail answer. A colleague asks his friend, a technologist, for the results of his…
A: A stakeholder is a person or group of people who works in an organisation or associated with it by…
Q: Are the two following statements true or false. 1) Is the allometric equation for metabolic rate MR…
A: Metabolism is the set of life-sustaining chemical reactions that are carried out in organisms. The…
Q: These are released by host cells in response to viral stimulation. Some act to prevent viral…
A: Introduction A virus is an infectious microorganism made up of a protein-coated segment of nucleic…
Q: A doctor is going to perform an amniocentesis to check for some important key developmental…
A: Amniocentesis is an important test or prenatal test that are useful to diagnose genetic disorders…
Q: Use the following information to answer then next question. Two different genes control the…
A: The different forms of a gene are called alleles. Each allele can have a distinct phenotype but the…
Q: Huntington's disease is caused by a autosomal dominant that is lethal in embryos in the homozygous…
A: Alleles are the alternative forms of a gene that are located on the same locus of a homologous…
Q: Examine whether the statement, "Pathogens must enter host cells to cause disease", is true or false.
A: A class of bacteria is generally known to state they are like pathogens capable of causing disease.…
Q: In guinea pigs, rough coat (R) is dominant to smooth coat (r). If a homozygous rough-coated animal…
A: Introduction:- Alleles are defined as the alternative forms of a gene. Alleles can be either…
Q: Draw a diagram/flowchart and describe in detail the process of normal clot formation AND breakdown,…
A: The understanding of the blood coagulation system has advanced recently in anesthetic practice.…
Q: What is the relation between theories and hypotheses?
A: A research proposal is a document that specifies the aims of the research and the techniques that…
Q: A woman that is AB Rh+/- marries a man that is BB Rh-/-. In the hospital there is a mix-up in the…
A: The genotype of the woman with AB blood group will be IA+IB- The genotype of the man with AB blood…
Q: A study by Calle, et. al., published in the New England Journal of Medicine showed that as BMI (a…
A: THE STUDY looked at the relationship between the BMI in 1982 and the risk of mortality from all…
Q: Describe the four processes that are fundamental to animal development.
A: The intricate process of animal development involves the transformation of a single-celled zygote…
Q: Give an interpretation of the results
A: Survivorship curve It is a graphical representation of the number of individuals surviving at each…
Q: Explain the process of transmission of oral-facial tumor of Tasmanian devil from one devil to…
A: Introduction: The Tasmanian devil is an Australian mammal, and Devil Facial Tumor Disease (DFTD) is…
Q: Task 2: Photosynthesis Article Read the Photosynthesis article on the Khan Academy website. As you…
A: DISCLAIMER FOR MULTIPARTSince you have posted a question with multiple sub-parts, we will solve…
Step by step
Solved in 2 steps
- Problem B. DNA: Codon SegmentingThe way that DNA is often interpreted as genes is in groups of three nucleotides at a time, called “codons.” Thus, the DNA strand dna_str = 'agctttcattctgac' Can be broken into codons in the following three ways: agc ttt cat tct gac a gct ttc att ctg ac ag ctt tca ttc tga c # reading frame 0 # reading frame 1 # reading frame 2 Notice that in these lines, we start reading codons at string indexes 0, 1 and 2. The three different start indices are known as reading frames, and are called reading frame 0, reading frame 1 and reading frame 2, respectively. It is not always clear which of these frames will be read by genetic transcription mechanisms, so it is often useful to be able to be flexible and consider any of them when working with DNA strands. Write a function segment that takes as an input a string containing a DNA strand, and a reading frame (0, 1 or 2) to use. The function should return a list containing the sequence of individual codons. You…Need help answering these questions: Looking at the picture attached, Notice the indel symbol at location 296 of the query. What is the corresponding amino acid in the subject? How many nucleotides were inserted/deleted here?Instructions: Express your own gene! (1) Make up a DNA sequence of at least 18nucleotides and then (2) show the mRNA sequence that will be made via transcription,(3) show the tRNAs that will base pair and deliver the amino acids, and (4) the aminoacid sequence of the resulting protein. You can use the single letter abbreviations forDNA and RNA nucleotides and the three-letter abbreviations for the amino acids.
- Instructions Using the Concord Consortium interactive, observe how mutations can affect protein formation and function. From your observations of the interactive, summarize your observations of how each change in DNA affects the protein that is made. Screenshots will be required for your assignment. Interpret and analyse your results: identify the type of mutation, and describe and explain the effect of each change on protein size, shape and polarity. Create two different mutation types and observe the different outcomes.RNA Transcription, Translation, and Mutation Worksheet First, here is a strand of DNA. This strand contains both a gene and its promoter region. Circle the promoter region in blue, draw a yellow box around the TATA box, draw a green box around the start codon, and draw a red box around the stop codon: TATATATATTACGTTGCATACGCTCAACGGTCGAAACTGCATGGGCAC ATATATATAATGCAACGTATGCGAGTTGCCAGCTTTGACGTACCCG Now imagine this gene has been transcribed into RNA. What would that RNA strand look like? Before the above RNA strand can be translated, a few modifications must first take place (in eukaryotes). What are they? 1) 2) 3) Using a codon chart of your choice (one can be found here, or here) translate the above RNA transcript (assume no splicing took place). Write the three letter abbreviations for the amino acids in the image below: Now imagine that a mutation took place in the original strand of DNA (marked in red) TATATATATTACGTTGCATACCCTCAACGGTCGAAACTGCATG…Sequence: CCACCTGTACCCGGACACACCCTGGTGTCC 1. Identify the gene from which the querysequence originates (Name of gene) 2. Provide the FULLprotein sequence encoded by the gene. 3. Are different splice variants known for this gene? 4. What human disease has been connected to this gene? 5. Calculate molecular weight (kiloDalton, kD) and calculated pI (the pH where the protein carries no net electrical charge) of the protein.
- Instructions: Read 13-2 Manipulating DNA pages 322-323. As you read each section, examine the figures and captions (explanations). Identify any questions you may have. 1) Develop an analogy for the processes researchers use to make changes to DNA. In yo analogy, explain how it is similar to the techniques used in genetic engineering. You can draw a graphic organizer, make a table, or write a few sentences describing your analogy. 2) Devise flowchart that shows the steps to prepare DNA for gel electrophoresis, as well the protocol for setting up and running a gel. You can add diagrams to the flowchart an add detailed notes if you like. English (inited Sate) O Focs ere to search 4 CO RU G\ L B. 2N A\ Alt CiriConcept Overview: Protein Synthesis Task 2: Review the process of protein synthesis by placing the cards in their appropriate category. Think before you drop - This is an all or nothing type of question. Double check that you are happy with where you placed all of the options before you submit the knowledge check. Transcription Translation No Answers Chosen No Answers Chosen Transcription & Translation Neither No Answers Chosen No Answers Chosen Possible answers DNA is copied into MRNA Involves tRNA | Occurs in the mitochondria Information in MRNA is used to produce a protein Occurs in the nucleus Involves mRNA Utilizes ribosomes Involves DNA polymerase Involves RNA polymerase Occurs in the cytoplasm :::: :::: ::::Molecular Biology (Biol-L211) Dr. Nole Central Dogma Practice - Processes The general flow of genetic information is diagrammed below. Think carefully about what type of molecule is represented by each item in the diagram and clearly address each of the following. A. Label each structure as mature mRNA, pre-mRNA, protein, or DNA. B. Label each arrow to indicate which is processing, transcription, replication, and translation. C. Identify the general location (on the appropriate molecule) of the promoter sequence and the terminator sequence. D. Identify the specific location of the place where the start codon and stop codon function most directly (i.e., which molecule is actually translated?). E. Where does RNA polymerase bind to begin transcription? F. Where specifically does the ribosome bind to begin translation-i.e., what are the ribosome binding sites (in both prokaryotes and eukaryotes) and where are they found? G. Label each end of the mature mRNA and the polypeptide to correctly…
- Molecular Biology (Biol-L211) Dr. Nole Central Dogma Practice - Processes The general flow of genetic information is diagrammed below. Think carefully about what type of molecule is represented by each item in the diagram and clearly address each of the following. A. Label each structure as mature mRNA, pre-mRNA, protein, or DNA. B. Label each arrow to indicate which is processing, transcription, replication, and translation. C. Identify the general location (on the appropriate molecule) of the promoter sequence and the terminator sequence. D. Identify the specific location of the place where the start codon and stop codon function most directly. E. Where does RNA polymerase bind to begin transcription? F. Where specifically does the ribosome bind to begin translation-i.e., what are the ribosome binding sites and where are they found? G. Label each end of the mature mRNA and the polypeptide to correctly specify polarity. (You should use the labels 3', 5', C-terminus, and N-terminus.)ACTIVITY 7.3.2 1. Name differences between replication and transcription. 2. Write the sequence of the RNA transcribed from the following DNA: 5' GATCAATGCTAG 3' 3' CTAGTTACGATC 5' 152 Copyright 2019. All Rights Reserved.(2/וt/ MODULE 11B- Transcription and Translation handouts Transcription and Translation Practice Worksheet nie For cach of the following sequences, fill in either the DNA, the mRNA sequence, the tRNA anticodons, or the amino acid scquences that have been left blank. If several sequences might work choose any one. ang IAC TGA TCG ACC ccc ATA ATG AAA ATC 1. DNA AUG ACU AGC UGG GGG UAU UAC UUU UAG MRNA unc uGA ucG ACc ccc AuA AUG AMA AUC (RNA AA 2. DNA TAC CGC ТСС GCC GTC GAC АСС AAT АСТ AuG GcG AGG CGG CAG cU uuA UGGUGA mRNA UAG CGc UCc Grs Guc GAC AAU ACC ACu tRNA AA TAC CGTGGG TTT TTC ATG GTT GGG TAA AuG GuG 3. DNA GGG GCA UAC CGA CCC uUA UAG mRNA tRNA UAC CAC ССС CGU AUG A AU GCU GGG AUC AA 4. DNA ATG CGI GGG TTI TTC ATG GTAGEG UAC GCA CCC AAA AAG UAC CAA mRNA AuG CGu GGG Wlir lur AuGGuu GGGUAA tRNA AA MET ARG GLY PHE PHE МЕТ VAL GLY (STOP) 5. DNA TAC CTCACA CTAGCT ATG 7G cc mRNA UGU GAU tRNA CU C UUG AUU Itr VAL LEU MET AA TFR ALA PRO