Below is the double-stranded DNA sequence of part of a hypothetical yeast genome, which happens to contain a very small gene. Transcription starts at the Transcription Start Site (TSS) after the promoter (in yellow) and proceeds in the direction of the arrow. Transcription stops at the end of the Transcription Terminator sequence on the right (in blue). 1. TSS 5 -CTATAAAGAGCCATGCATTATCTAGATAGTAGGCTCTGAGAATTTATCTCACT-3' TI||||| 3'-GATATTTCTCGGTACGTAATAGATCTATCATCCGAGACTCTTAAÄTAGAGTGA-5' Which strand of DNA shown, the top or the bottom, is the template strand? Explain 'briefly why a) b) Which strand of DNA shown, the top or the bottom, is the coding strand? c) Write the first 10 bases of the sequence of the MRNA produced from this gene? Label the 5' and 3' ends?
Q: Consider this list (below) of steps involved in transcription. These steps are out of order.…
A: Replication, transcription, and translation are used by all cells to keep track of their genetic…
Q: Which of the following is a property or characteristic of eukaryotic promoters? O They contain the…
A: Promoters in transcription are actually certain specific sequences of DNA that define the starting…
Q: Consider the Rho-dependent terminator sequence 5’CCCAGCCCGCCUAAUGAGCGGCCUUUUUUUU-3’. What affect…
A: The mutation is the change in the nucleotide sequence of the DNA. The point mutation is the mutation…
Q: Shown below is the genomic structure of the human B-globin gene. The numbers within the boxes…
A: Transcription is the process by which DNA act as template for the formation of mRNA . This process…
Q: Below is a diagram of a gene that is not normally alternatively spliced. All four exons (represented…
A: Point mutation refers to any change in a single nucleotide of a gene.
Q: The coding sequence for gene F is read from left to right on the accompanying figure. The coding…
A: DNA is the polymer of nucleotides.
Q: Transcription Translation stop site start site Intron 1 Promoter Exon 1 Exon 2 Intron 2 Exon 3 |…
A: Any alteration in the nucleotide sequence of a gene is mutation. A mutation in the gene sequence can…
Q: The following DNA nucleotides are found near the end of a bacterial transcription unit.…
A: The process in which a specific sequence of DNA is copied to form a newly synthesized strand of…
Q: Which of the following is a sequence of DNA where transcription is initiated? a. Kozak sequence.…
A: Transcription is a heterocatalytic action of an DNA by means of which RNA is synthesized from…
Q: For the following gene, which type of regulatory sequence has likely been deleted in mutant 1?…
A: Transcription is the mechanism by which an RNA copy of a gene sequence is produced. This clone,…
Q: First, I bind to an unstructured region of RNA and moves toward its 3’ end. Then RNA polymerase…
A: Rho, in rho- dependent terminators in bacteria.
Q: lthough the transcription start site begins at the underlined C/G, which of the following is the…
A: Answer- Transcription is the synthesis of mRNA from the coding strand of DNA by the help of RNA…
Q: The following sequence is a mutant version of the above gene that is present in a mutant bacterial…
A: As required, only E and F has been answered.
Q: Below is a diagram of a gene that is not normally alternatively spliced. All four exons (represented…
A: Transcription is the synthesis of mRNA from the DNA. Northern blotting is used to study the mRNA and…
Q: This is a double-stranded DNA sequence—with no introns—that codes for a small protein (this is a…
A: The DNA is transcript into mRNA by the process of RNA transcription with the help of RNA polymerase…
Q: Gene 1 Gene 2 Gene 3 ori 3' DNA E -5' transcription 5' 3' 5' 3' 3' 5' MRNA 1 MRNA 2 mRNA 3…
A: INTRODUCTION: In bacterial chromosome, related genes are found in the cluster on the chromosome,…
Q: When wild-type E. coli are grown in media with high lactose and no glucose, which of the following…
A: The lactose operon (lac operon) is an operon required for the transport and metabolism of lactose in…
Q: Select the following descriptions of gene transcription regulation in eukaryotes that are…
A: * Post translational modification are covalent and enzymatic modifications of proteins that follows…
Q: A bacterial species has a hypothetical sigma promoter that has the following sequence: TTGGCA -…
A: Promoters are essential components of expression vectors because they regulate RNA polymerase…
Q: 3. Animation 11.3: Refer to the table. Step Description RNA polymerase and other transcription…
A: The transcription is the production of RNA from the DNA template and the beginning of transcription…
Q: What happens when EF-Tu is mutated? Choose from the options below. Be involved in transcription…
A: Elongation Factor Thermo Unstable (EF-Tu) is one of the most prevalent proteins in bacteria, making…
Q: Shown below is an E. coli's DNA sequence coding for XXR protein. The nucleotides are numbered 1 to…
A: Here I will provide you first 10 nucleotides long mRNA sequences according to question.
Q: The diagram below depicts an active transcription bubble after a short period of RNA synthesis…
A: Transcription involves the copying of information from a strand of DNA into a new molecule of…
Q: Which of the following processes is required for the initiation of transcription in bacteria? Select…
A: Transcription is the process of formation of mRNA by utilizing a DNA template. This process is…
Q: w is the diagram of a eukaryotic gene that encodes a protein. The promoter and n start sites are…
A: Post transcriptional modification removes introns and add existing exons together in the primary RNA…
Q: A bacterial species has a hypothetical sigma promoter that has the following sequence: TTGGCA -…
A: The sequence of nucleotides required for the initiation of transcription is known as the sigma…
Q: Eukaryotes can control transcription by three overall type of process, they are ( selection from…
A: The regulation of transcription is more complex in eukaryotes as compared to prokaryotes. This…
Q: The –35 sequence of a particular bacterial gene is 5′– TTAACA–3′. A mutation changes the fifth base…
A: Genetic codes are triplet, ambiguous, degenerate and non-overlapping. Three bases codes for an amino…
Q: You are searching the sequence of a coding strand of DNA. What kinds of sequences would help you…
A: A nucleic acid is a linear polymer of nucleotides that is a component of the cell's information…
Q: Which of the following is correct about transcription? options: The reaction is driven…
A: Transcription It is the process of synthesis of pre mRNA from DNA.
Q: What are the specific steps of eukaryotic transcription? Be sure in your discussion that you include…
A: Transcription is the process which consist of several steps of DNA based gene expression.Here a…
Q: Shown here is a DNA sequence. The promoter is highlighted in yellow and the terminator is…
A: Given: Sequence of template DNA is…
Q: man rhodopsin gene is 2675 nucleotides long from transcription start site to transcription stop…
A: The rho factor provides directions for creating a macromolecule referred to as rhodopsin. This…
Q: Write out the sequences of the two conserved elements in the following bacterial promoter. The…
A: In the transcription unit, the transcription start site is marked as +1.
Q: The following represents a transcription unit in a hypothetical DNA molecule in E.coli.…
A: DNA ( Deoxyribonucleic acid ) is a double stranded molecule whereas RNA is single stranded.…
Q: How would transcription be affected in eukaryotic cells if Mediator was deleted? Group of answer…
A: Introduction: The process involving the copying of the stored information in the strand of DNA or…
Q: Consider the Rho-dependent terminator sequence 5’CCCAGCCCGCCUAAUGAGCGGCCUUUUUUUU-3’. What affect…
A: Introduction Termination of transcription: It involves the termination of RNA chain synthesis by…
Q: Shown below is a very short gene of an unknown bacteria genome (Figure 2). Transcription starts at…
A: Transcription proceeds until the main enzyme RNA polymerase encounters a termination sequence that…
Q: Microbiologists describe the processes of transcription and translation as “coupled” in bacteria.…
A: DNA serves as a genetic material and carries genetic information from one generation to another. DNA…
Q: You are teaching a class on the regulation of eukaryotic gene expression. In order to demonstrate…
A:
Q: For the following gene, which type of regulatory sequence has likely been deleted in mutant 1?…
A: Transcription is the process of expression of genes and by this process RNA transcript is produced…
Q: Shown is a segment of DNA with its promoter and terminator. Start and end of transcription are…
A: Transcription is the phenomenon in which one stranded RNA is synthesized from DNA strand . But RNA…
Q: Shown below are different regions of an eukaryotic gene. Which of the above regions of a gene will…
A: Transcription is the process by which the information in a strand of DNA is copied into a new…
Q: The sigma factor protein's role in transcription in E. coli includes which of the following?…
A: Sigma factors are subunits of RNA polymerase in bacteria. They control synthesis of RNA intitiation.…
Q: help
A: The copying of the template DNA on the mRNA is called transcription. The formation of mRNA is…
Q: Transcription of protein-coding genes in the eukaryotic nucleus a. produces mature mRNAs. b. is…
A: TRANSCRIPTION:- During the process of gene expression, DNA is first copied into an mRNA molecule…
Q: You are studying the rate of transcription of a particular eukaryotic gene. When the DNA located…
A: Transcription is copy of genetic information from DNA to RNA. Eukaryotic transcription is more…
Q: The figure shows a Venn Diagram with four areas, Area A- Terms that only apply to eukaryotic…
A: The proteins are synthesized with the correct amino acid sequence based on instruction in DNA. This…
Q: Using the transcription unit diagrammed below, in which exons are represented by blue boxes and…
A: Transcription is the process of synthesising mRNA from the template strand of DNA.
Q: The human rhodopsin gene is 2675 nucleotides long from transcription start site to transcription…
A: Throughout an organism's life, the original DNA (deoxyribonucleic acid) molecule in the nucleus acts…
Trending now
This is a popular solution!
Step by step
Solved in 2 steps
- The following double-stranded DNA sequence is part of a hypothetical yeast genome which contains a very small gene. Transcription starts at the Transcription Start Site (TSS), proceeds in the direction of the arrow and stops at the end of the Transcription Terminator (green box). 5' 3' TSS CTATAAAAATGCCATGCATTATCTAGATAGTAGGCTCTGAGAAATTTATCTCACT | | | | | | | | | | GATATTTTTACGGTACGTAATAGATCTATCATCCGAGACTCTTTAAATAGAGTGA - 5' PROMOTER TERMINATOR 3' a) Which strand (top or bottom) is the template strand? Explain why. b) What is the sequence of the mRNA produced from this gene? Label the 5' and 3' ends. c) What is the sequence of the protein produced from the mRNA? d) If a mutation (an insertion) were found where a T/A (top/bottom) base pair were added immediately after the T/A base pair shown in red, what would be the sequence of the mRNA? What would be the sequence of the protein?Below is the double stranded DNA sequence of part of a hypothetical yeast genome encoding a very small gene. Transcription starts at nucleotide immediately following the promoter. The termination sequence is TATCTC. How many amino acids will this protein have? 5' TCATGAGATA GCCATGCACTA AGGCATCTGA GTTTATATCT CA 3' 3' AGTACTCTAT CGGTACGTGAT TCCGTAGACT CAAATATAGA GT 5'The diagram below shows an imaginary eukaryotic structural gene containing two exons. The exon nucleotides are numbered beginning at the transcription start site and a portion of the intron is not shown to save space: Help Center? transcription start site promoter U STACAGTATAAATGAATTAATTGACGTATGTCAATCGGTAAGT...TCAGGTACT U UUU} Phe UUG} Leu exon 1 3 ATGTCATATTTACTTAATTAACTGCATACAGTTAGCCATTCA...AGTCCATGAATGACTTATGTGCGGTTATTTACTGAT... Second letter C Predict the amino acid sequence of the polypeptide encoded by this structural gene. The genetic code is provided below.
- b) Shown below is a very short gene of an unknown bacteria genome (Figure 2). Transcription starts at Transcription Start Site (TSS) and terminates at the Terminator site. TSS 5'TATTATTAACGCATGACGAGCCATGCATTATCGGTATATGCACTGACCCGGRAAGGCTCCTTTTGGAGCCTTTTTT-3' 3' ATAATATTGCGTACTGCTCGGTACGTAATAGCCATATACGTGACTGGGCCTTTCCGAGGAAAACCTCGGAAAAA-5' Promoter Terminator Figure 2 Based on the double-stranded DNA sequence of terminator, draw the structure of hairpin loop that will be formed during transcription. Illustrate how the hairpin loop structure initiates the termination of transcription.The following segment of DNA is part of the RNA-coding sequence of a transcription unit. If the bottom strand is template, which of the following RNA sequences would be transcribed? DNA: 5-'ATAGGCGATGCCA-3' 3'-TATCCGCTACGGT-5' O 5'-UAUCCGCUACGGU-3' O 5'-ACCGUAGCGGAUA-3' O 5'-AUAGGCGAUGCCA-3' O 5'-UGGCAUCGCCUAU-3'Shown below is an E. coli's DNA sequence coding for XXR protein. The nucleotides are numbered 1 to 330. Transcription starts at the Transcription Start Site (TSS) that is the base located at position 57. -55 5' AATAAСTTGAGATTTTGATTGACАТССТТСТСАCAGAGCCTATAATACCТАТТТС 3' 3'TТАТTGAACTСТААААСТААСТGTAGCAACAGTGTCТСGGATATTATGGATAAAG 5' 56- 5' ТACGTATAGAСАСТСAGAGGAAAGACAGAGAGAGAGTTAGCATTGTACTАТСТСТ 3' 3' АTGCATATСТсTGAGTCTCCTTтстстстстстсТСААТСGTAACATGATAGAGA 5' 65- -105 --110 -140- 5' СТTTTAGATATATCTCТАТСТСТСТСАСТССАТСТТТСТCGTGTTAACACAAСА 3' 3' GAAAATCTATАTAGAGATAGAGAGAAGTGAGGTAGAAAGAGCACAAТТСTСТTGT 5' 111- -120- -130- -150- -160----165 166- --175- --185- -195 -205- -215-----220 ------- 5' GTCACAGACTCACAGATCTTTGTCGGTGATCGGAGATGGAGTTCCGGGAGAAGCT 3' 3' CAGTGTCTGAGTGTCТAGAAACAGCCACTАGССТСТАССТСААGGCCCTСТТCGA 5' 221- -230- 240 -250 -260 -270-----275 5' TTATAAGTTCAAGTTGCAATAGGTGTTTGCCTTTGTTTTATCTCTCCTCACCGTA 3' 3'ААТАТТСААGTTCAACGTTATCCАCAAACGGAAACAAAАТAGAGAGGAGTGGCAT 5' 276- -285- -295- -305 -315…
- Below is a diagram of an Oscar Miller (Christmas tree) spread. Which of the following is true? Wy O a. this represented the first example in eukaryotes in which translation was visualized with the electron microscope O b. each "Christmas tree" represents the transcription of a single type of rRNA (i.e. 28S or 18S or 5.8S) O c. as drawn, transcription is proceeding from left to right Od.three nucleolar organizer regions are shown 1Consider this list (below) of steps involved in transcription. These steps are out of order. TRANSCRIPTION: 1. mRNA travels through a nuclear pore and enters the cytoplasm 2. the mRNA polymerase attaches at the start of a specific gene 3. RNA polymerase reads the gene surface4. a transcription factor bonds to a promoter site5. DNA molecule is unwound 6. a complimentary mRNA is produced What is the correct order of this transcription?Consider the Rho-dependent terminator sequence 5’CCCAGCCCGCCUAAUGAGCGGCCUUUUUUUU-3’. What affect would a point mutation at any one of the bolded and underlined nucleotides disrupt termination of transcription? Group of answer choices Mutation in one of these nucleotides would disrupt base pairing, preventing the formation of the hairpin and disrupting termination. Mutation in one of these nucleotides would have no affect on base pairing, so the termination hairpin is formed and termination proceeds. Mutation in one of these nucleotides would not disrupt base pairing, but would prevent the formation of the hairpin and disrupt termination. Mutation in one of these nucleotides would disrupt base pairing, but not affect the formation of the hairpin and termination proceeds.
- c) A gene in a bacteria has the following DNA sequences (the promoter sequence is positioned to the left but is not shown): 5'-CAATCATGGAATGCCATGCTTCATATGAATAGTTGACAT-3' 3'-GTTAGTACCT TACGGTACGAAGTATACTTATCAACTGTA-5' i) By referring to the codon table below, write the corresponding mRNA transcript and polypeptide translated from this DNA strand. 2 Second letter с A UUUPhe UAU Tyr UAC. UGU UGCJ UCU) UCC UCA UUG Leu UCG Cys UUC UUA Ser UAA Stop UGA Stop A UAG Stop UGG Trp G CUU CÚC CCU ССС CAU CGU His САC Pro CC CỦA Leu ССА CAA Arg CGA CUG J CCG) CAG Gin CGG AUU ACU AAU Asn AGU Ser AUC le АСC АCА AAC AAA AGC. Thr JArg AUA AGA AUG Met ACG AAG Lys AGG. GAU Asp GUU) GCU GCC GCA GCG GGU" GGC GGA GGG GUC Val GUA GAC Ala Gly GAA Glu GAGJ GUG ii) If the nucleotide indicated by the highlighted bold letter undergoes a mutation that resulted in deletion of the C:G base pair, what will be the resulting amino acid sequence following transcription and translation? Third letter DUAG DUAG DUAG A. First…The double stranded DNA sequence shown contains the promoter for the transcription of a bacterial gene. GGCACCTGCGATGCATGAATATATCGATCGGGAATCGCTATGTCAAGCCATGGCTAGATTA CCGTGGACGCTACGTACTTATATAGCTAGCCCTTAGCGATACAGTTCGGTACCGATCTAAT Draw a box around each of the promoter elements and identify each. Identify which strand will be used as the template strand by putting a vertical line between the -1/+1 start site nucleotides and underlining in the direction of transcription on the template strand as the example below indicates. ATCGG\GAATCGC TAGCCCTTAGCG Give the sequence of the RNA createdConsider the Rho-dependent terminator sequence 5’CCCAGCCCGCCUAAUGAGCGGCCUUUUUUUU-3’. What affect would a point mutation at any one of the bolded and underlined nucleotides disrupt termination of transcription? Group of answer choices 1.Mutation in one of these nucleotides would disrupt base pairing, but not affect the formation of the hairpin and termination proceeds. 2.Mutation in one of these nucleotides would have no affect on base pairing, so the termination hairpin is formed and termination proceeds. 3.Mutation in one of these nucleotides would not disrupt base pairing, but would prevent the formation of the hairpin and disrupt termination. 4.Mutation in one of these nucleotides would disrupt base pairing, preventing the formation of the hairpin and disrupting termination.