Early genes Late genes Promoter Promoter Viral genome Transcription mRNA Translation
Q: he enzyme used in the formation of cDNA from mRNA isa) Polymeraseb) Helicasec) Reverse…
A: In gene cloning, the chromosomal DNA and vector DNA are used to get multiple copies of genes. The…
Q: RNA polymerase starts synthesizing RNA at the _______ start codon TSS first exon
A: To start deciphering a gene, RNA polymerase ties to the DNA of the quality at a district called the…
Q: Reverse transcriptase assembles a(n)_____ on a(n)_____ template. a. mRNA; DNA c. DNA; ribosome b.…
A: DNA (Deoxyribonucleic acid) is the hereditary material present in most of the living organisms ,…
Q: The HIV virus produces copies of its genome through: A. DNA replication B. Reverse…
A: HIV (human immunodeficiency virus) is a type of RNA virus that affects the person's immune cell.…
Q: Short sub-sequence of a cDNA sequence isa) Expressed sequence tagb) Sequence tagged sitec) Contigd)…
A: Introduction Some RNA viruses have a special enzyme called as Reverse transcriptase which help in…
Q: DNA RNA polymerase enhancer TATA transcription factors
A: The branch of biology deals with cellular molecules like proteins and the nucleic acids responsible…
Q: In an HIV infection, this enzyme is responsible for copying theRNA information in the virus into…
A: HIV or human immunodeficiency virus is a virus that causes AIDS (acquired immunodeficiency syndrome)…
Q: Assume that this DNA molecule is from a eukaryotic cell. Draw the approximate location of an RNA…
A: Step 1 The segment of the template strand which takes part in transcription is called transcription…
Q: DNA message #6: GTA-CGA-TGA-ACA-GTG-CTT-TGC Transcription to mRNA: CAU GCU ACU UGU CAC GAA ACG…
A: DNA( deoxyribonucleic acid) is the double-stranded molecule that is the genetic material in most…
Q: Which of the following phrases does not describe a function of the promoter? a. Serves as sequence…
A: DNA transcription is the process of the formation of messenger RNA(mRNA) from DNA. The genetic…
Q: The foloving dagram represents a transcription unit (a gene) and corresponding RNA transcripts being…
A: The piece of DNA that take part in transcription is called transcription unit. Transcription unit…
Q: The site of transcription initiation is the promoter. sigma factor. start codon. origin of…
A: The gene expression involves transcription as its first step. This step involves the formation of…
Q: Prokaryotes are lacking. in their DNA sequence. A. introns B. exons. O C. promoter sites D. operons
A: Prokaryotes are the primitive type of cells that don't have membrane bound organelles and have the…
Q: RNA polymerase Il promoters are located on the side of the template strand a. internal b. C-terminal…
A:
Q: DNA message #5: AGT-GTG-CGG-GCC-GGG-ACT-ATT-ACT Transcription to mRNA: UCA CAC GCC CGG CCC UGA UAA…
A: CENTRAL DOGMA- The process of Replication is when DNA replicates itself means it will make copies…
Q: RNA polymerase binds to a _________ to initiate _________. a. mRNA; translation b. promoter;…
A: RNA polymerase is the enzyme that is responsible for the synthesis of mRNA from genomic DNA.
Q: viral and human transcription is different. What molecule is used as a template strand for the viral…
A: Transcription is the process of making RNA copy of a gene sequence. It takes place in nucleus.
Q: in the process of transcription, _____. mRNA attaches to ribosomes RNA is synthesized…
A: Transcription is the cycle by which the information in a strand of DNA is duplicated into another…
Q: "Builders" Initiation Termination Input/Starting Monomers Product/Final Signal Signals (think…
A: Replication, transcription and translation all these processes occurs in 3 steps- initiation…
Q: What type of RNA corresponds to the statement? Choices: mRNA, tRNA, Prokaryotic, rRNA, Eukaryotic,…
A: RNA is a polymer of nucleotides attached together via phosphodiester bonds. RNA is generally…
Q: Transcription V [Choose ] Coagulase RNA polymerase Translation DNA polymerse Ribosome Reverse…
A: The central dogma of molecular biology suggests the flow of genetic information from DNA to rna to…
Q: The operator is the side of the DNA where ---- binds 1. Repressor 2. DNA polymerase 3. Ribosome…
A: INTRODUCTION An operator is a genetic sequence which allows proteins responsible for transcription…
Q: The function of reverse transcriptase is toa. copy RNA into DNA.b. copy DNA into RNA.c. translate…
A: Retrovirus is a group of viruses that belong to the family Retroviridae and they have the RNA as…
Q: Teminator Promoter Gene (DNA) AUG UA Exon 1 Exon 2 Exon 3 Exon 4 Intron 1 Intron 3 14 Intron 2 15 15…
A: To initiate transcription, RNA polymerase binds to the promoter, so the promoter helps in…
Q: Location/enzyme DNA Process RNA polymerase Transcription RNA transcript Ribosome Protein Translation
A: Nucleus is a main controller of the cell which carriers genetic instructions . It consists of…
Q: Name of the enzyme that adds RNA Nucleotides during Transcription? O Helicase O Primase ODNA…
A: Option 4 is the answer.RNA polymerase.
Q: RNA-dependent RNA polymerase performs which of the following functions? O 1) Uncoats the viral…
A: Various different kinds of enzymes are involved in the replication, transcription, and translation…
Q: An example of RNA-dependent DNA polymerase isa) Reverse transcriptaseb) DNA ligasec) RNA polymerase…
A: Polymerases are the enzymes involved in the synthesis of nucleic acids. They can be DNA-dependent or…
Q: Match the terms with the best description.____ genetic message a. protein-coding…
A: A gene is a specific sequence of nucleotides in DNA or RNA that is usually found on a chromosome and…
Q: To initiate transcription. binds to a specific • called the , located at the 5' end of a gene. DNA…
A: Transcription is the process of making an RNA copy of a sequence of gene. This copy, called as the…
Q: Part 1: transcription (DNA- mRNA) 1. You are now inside of a cell, looking at a strands of DNA. Look…
A: Genes are the functional segments of DNA.
Q: TOIC Stimulus EUkaryotic cell mi RNA Protein SUp nucleus Deg target mRNA:
A: The diagram illustrates an eukaryotic cell in which micro RNA binds to the target mRNA which has…
Q: Which macromolecule is made by the enzyme reverse transcriptase
A: Option D - cDNA
Q: During transcription, ___________________. a. A cell divides to make 2 new cells b. A cell divides…
A: Transcription small explanation is provided in the below step.
Q: The template in a double strand rna transcription reaction is... dna bicleotid double rna single…
A: RNA is the genetic material of most viruses while DNA is the genetic material of most living…
Q: An RNA which has a functional group that allows to act as a catalyst a generally caled A SRP B snRNP…
A: Enzymes are biocatalysts. Enzymes speed up the reaction.
Q: The process of transcription directly results in the synthesis ofa. DNA.b. RNA.c. a polypeptide.d.…
A: The central dogma of molecular biology explains the flow of genetic information through the…
Q: The function of ligase is toa. rejoin segments of DNAb. make longitudinal cuts in DNAc. synthesize…
A: Introduction DNA replication is very crucial process for the continuation of life as every new…
Q: Mismatch Carbon Donor Clonin plasmids endotoxin Mutagen Nucleotide Termination Source DNA cell…
A: Since you have asked multiple questions , we will solve the first question for you. If you want any…
Q: Which of the following is RNA-dependent RNA polymerase?a) Reverse transcriptaseb) RNA polymerase Ic)…
A: RNA Polymerase is an enzyme that brings about polymerization of ribonucleotides to form RNA. Usually…
Q: MRNA build to match the DNA message letter by letter
A: DNA is a double helix with two strands of polynucleotides.
Q: Mechanisms that govern gene expression do not operate during______ . a. transcription c. translation…
A: Gene expression is a process in which a gene is expressed into a gene product. A gene is a piece of…
Q: When RNA polymerase transcribes DNA, only one of the two DNA strands is used as a template. Take a…
A: The genetic information flows from DNA to RNA to protein and it involves sequential process of…
Q: Transfer RNA molecules are involved in transcription translation O replication reverse transcription
A: t-RNA or transfer RNA molecules have a specific clover leaf-like structure. Generally, RNA molecules…
Q: DNA ATG AGG 11 13 --UCA- MRNA 12 14 TRNA 10 Ser 15
A: The base pairing of DNA and RNA differ slightly in their nucleotide bases. DNA uses the bases…
Q: Messenger RNA is formed by ________ of a gene on the DNAtemplate strand.a. transcription b.…
A: A gene is the essential physical and the functional unit of heredity. Genes are made up of DNA…
Q: a. Genome Project-write b. Mitochondrial DNA 'Spring Cleaning' c. Micro-encapsulation с. d. Specific…
A:
Q: Which RNA polymerase makes tRNA? RNA pol I RNA pol II RNA pol III RNA pol IV
A: The production of RNA from the DNA template is known as the transcription process that occurs within…
Q: You know how the body using mRNA to create protein. Describe to someone how the cell will be able to…
A: mRNA vaccines instruct our cells about how to produce a protein that triggers an immune response…
Explain the figure below according to virology .
Step by step
Solved in 3 steps
- CATCTACAAATAGCACCTAATTGTG What is the MRNA What is the protein What is the phenotypeGGGAGTGTATACGGGATGAAGGCGATT MRNA What’s the Protein And what’s the phenotypeintron-Seauence of nueleotides klith in the gene but are r emeved fürm the Ŝeaçuente a final MKNA moleciles Is made. 31. How does an RNA molecule get modified (what part is kept and what molecules are used, what gets added on)? before
- Mechanisms that govern gene expression do not operate during ___ . a. transcription b. RNA processing c. translation d. knockoutsGENE E DNA TTTAA A MRNA Amino Acidanswer all subpart to upvote because vert short question otherwise dislike Viruses that infect bacteria (bacteriophage) sometimes encode a lysozyme gene in their genome. The gene gets inserted into the bacterial genome and gets expressed in the same way that bacterial genes get expressed. A) What location in the bacterial cell would the gene get transcribed into mRNA? (1 sentence max) B) What protein complex would perform the transcription to produce the mRNA? (1 sentence max) C) Where in the bacterial cell would the gene get translated? (1 sentence max) D) What protein complex would perform the translation to produce the protein? (1 sentence max)
- Name: Date: 2. The sequence of a fragment of one strand of DNA is AATTGCATATACGGGAAATACGACCGG. Transcribe this s sequence into MRNA. er bns eldst eboo oi ebitqeqylog erlt to noihiog eri qu elsm bluow tsri abios onime Jlaw as ye s 1ot noitem atelomet AHG 3. The following MRNA ştrand is being used to asemble a polypPLEASE FL OUT TABLE USING INSTRXUTIONS -USE BASE PAIRING RULES TO COMPLETE SECOND COLUMN FOR EACH MUTATION WRIYE IN ANY MRNA DOEONS RHAT WILL BE FHANGED AS THE REEULR OF RHE MURATION AND USE X MARKS RO INDÍCATE DOONS THAT WONT BE FHANGES CIRCLE STOP CODONSPlssssss helppppp, I already completed the mRNA column, pls help me complete the AA column
- GTTTTCACTGGCGAGCGTCATCTTCCTACT 8. What is the function (e.g. transcriptional regulation, transmembrane signaling, kinase, protease, etc.) of the protein(s) encoded by the gene.Label promoter and terminator regionsebitgeqyloq erl to noihoq ertt qu 9lem bluow iert ebios onime et enimalsb nworle llew as yes TOi noitemoini ebulonl elelgmst AMO 3. The following MRNA strand is being used to assemble a polypeptide strand by a ribosome: 5'-AUGCUUGCUCAUCGGGGUUUUAA-3' AHR (a) Write out the amino acids that will be assembled, in their correct order. (b) Provide an alternative MRNA sequence with four or more changes that would translate to the same amino acid sequence.
