Couren betone antionsнеin which aminoexistinlife(9)Lamino(b)D- amimoacidaon earth nacidsacidsmeither Dor L(d) Both9 and I exist in lifeGIVE HAND WRITTEN ANSWERwith Explantation

Amino acids are organic molecules that act as the building blocks of proteins. D and L represent…

Answered: Comien belone options in which amino…

Comien belone options in which amino exist in (9) (b) acida life on earth n acido a cias I amimo D- amimo meither Dor L (d) Both GIVE HANDWRITTEN ANSWER with Explantation I and I exlit in life

Biology: The Unity and Diversity of Life (MindTap Course List)

14th Edition

ISBN:9781305073951

Author:Cecie Starr, Ralph Taggart, Christine Evers, Lisa Starr

Publisher:Cecie Starr, Ralph Taggart, Christine Evers, Lisa Starr

Chapter3: Molecules Of Life

Section: Chapter Questions

Problem 3SQ: _______ groups are the acid part of amino acids and fatty acids. a. Hydroxyl (OH) b. Carboxyl (COOH)...

See similar textbooks

Related questions

Q: When an inappropriate amino acid is substituted in place of another, as occurs in certain genetic…

A: Though proteins are made up of hundreds of amino acids but each amino acid is important in the…

Q: The nucleotide is adenine adenosine adenosine monophosphate cytidine prion

A: A nucleotide is the basic building block of nucleic acids like RNA and DNA. The nucleic acids act as…

Q: 25- General formula of alkyne compounds are. O A A - CnH2n+2 O B - CnH2n-2 O C - CnH2n

A: Alkynes are hydrocarbons that have triple bonds between carbon atoms.

Q: Tyrosinase enzyme activity is assayed by monitoring the oxidation of 3, 4-dihydroxyphenylalanine…

A: Enzyme activity is defined as the micromole of the substrate formed per minute of reaction. Specific…

Q: What happens when a protein is denatured? The chemical bonds are not impacted, but the protein shape…

Q: Criven below givers are some statement in which of the Coenzymes withe their vitamin enyame and…

A: Coenzymes are essential for some Enzymes to carryout their catalytic activity. Coenzymes can alone…

Q: There are many different routes by which drugs can be administered. Describe the pros and cons of…

A: Introduction: Drug administration is giving the medicine or the prescribed drug to an individual.…

Q: Explain the experiment performed by C. Anfinsen with ribonuclease A and formulate the Anfinsen dogma…

A: Anfinsen sought to show that the protein's amino acid sequence contained all of the data necessary…

Q: Information for Part 2 The following table shows the concentration of ATP, ADP and phosphate into…

A: In the above question the change in free energy can be calculated by Δ?′ = Δ?0 + ?? ln ([???][??]/…

Q: (5')GTGATCAAGC(3') could only form a double-stranded structure with: a. (5')CACTAGTTCG(3'). b.…

A: Double-stranded DNA is made up of two polynucleotide chains linked together by nitrogen bases.…

Q: full oxidation of 2 moles of glucose produce 36ATP O 72ATP 48ATP O 106ATP O

A: Anaerobic or aerobic respiration can occur within a cell.

Q: 1. Which of the following TCA cycle intermediates is also a metabolite in gluconeogenesis? a.…

A: As distinct to glucose that is converted from the large storage molecule glycogen, gluconeogenesis…

Q: Cofactor Nucleoside Homocysteine Sphingolipid 6. 7. 8. 9. НО НО ОН P-O но о 0=р НО. Но НО 10. НО. но…

A: A nucleotide is the basic building block of nucleic acids (RNA and DNA). Phospholipids constitute…

Q: Which of the following is not a mechanism of enzyme regulation? Activation by proteolysis Multiple…

A: Transfigural control

Q: Devise a laboratory exercise based on the Lieberman-Burchard Test for Lipids. • 1. Aim 2.…

A: Lipids are important in biochemical processes because they serve as an efficient source of energy…

Q: Which of the following regarding disulfide bonds is/are true?

A: Proteins are polymers of amino acids which are linked by peptide/amide bonds and form primary…

Q: Question 4. If you were to synthesize a tetrapeptide consisting of all alanine residues, you would…

A: Tetrapeptide with all the alanine residues will be called polyalanine. These alanine residues will…

Q: .Role of liver in carbohydrate and lipid metabolism

A: Liver is the most flexible metabolic organ in higher vertebrates. The diet we eat can vary in its…

Q: Given the active site diagram below, which of the indicated components is/are necessary for proton…

Q: Given the active site below, which best describes the mechanism(s) of catalysis? 5 NH 2 *H₂N. HN O…

A: Active site: The area of an enzyme's active site is where substrate molecules interact and engage…

Q: I. Identify the D,L convention of the following monosaccharides CHOV HOSIT H -OH H- -OH HOH -OH 196…

A: a: L-Altrose b: D-Allose c: D-Mannose For identifying the convention of D and L, the structure…

Q: Which of the following statements regarding enzyme catalysis is false? All options are false. Once…

A: Biochemical reaction tend to be slow, unlikely or unfavorable in the chemical environment is the…

Q: -120 2 1, 2, 4 1,3,4 60 2,3 3 180 All of the answers are correct

A: Ramchandran plot is a two dimensional plot used to visualize energetically allowed regions for…

Q: Name and in a brief describe the process by which immunological diversity is generated.

A: The ability of multicellular creatures to withstand dangerous germs is referred to as immunity.…

Q: Which of the following secondary structures would you expect to find on the surface of a globular…

A: Proteins are composed of amino acids. They are linked together by peptide linkages. Proteins have…

Q: What moieties within oligopeptide are those mainly responsible for the formation of an alpha-helix?…

A: Proteins or polypeptides are the biomolecules that contain amino acids bonded via peptide bonds.…

Q: The key to biopolymer self-replication is:

A: Ans. Option b and c is correct Biopolymer are the polymers that entire life depend on them. It could…

Q: Which of the following is/are a nucleophile(s) at pH 12? O guanidinium O hydroxyl O thiol amine Both…

A: Amino acids are compounds containing carbon, hydrogen, oxygen and nitrogen and serve as monomers of…

Q: ZI A IZ НО. B OH IZ N H НО, E ZI .N.

Q: Which of the following are correct about C 4 Cycle and C 4 plants? P. Phosphoenolpyruvate…

A: The correct answer is (a) Q and S.

Q: Q/What are the Irreversible inhibitor ?

A: Inhibitor is an agent that slows or interferes with the chemical reaction. Enzyme inhibitor is a…

Q: 3-day -old female newborn with a deficiency of mitochondrial carbamoyl phosphate synthetase develops…

A: Carbamoyl phosphate synthetase is an enzyme which catalyzes the first reaction of the urea cycle.…

Q: true. D = if both sentences are false. Rudolph Virchow took the lead of introducing the concept of…

A: In the first question the correct option would be (B). Cell division is mainly of two types- Mitosis…

Q: Considering the monosaccharide transformation given below, what is the name of the depicted…

A: Introduction: Carbohydrates are large biomolecules that are mainly synthesized during the process of…

Q: Assume that the 2nd carbon atom of pyruvate is labeled with C14 and then the labeled pyruvate is…

A: Recall that during glycolysis, glucose is converted to pyruvate. Pyruvate enters TCA as acetyl CoA…

Q: Metalloproteases can contain a catalytic triad made up of: D(H₂O)D E(Ln*)S

A: In transferase and hydrolyses enzymes catalytic triad is found. In the active site of the enzymes…

Q: What defect in the cell causes the condition known as Zellweger's syndrome, ZS? Explain in detail…

A: Zellweger syndrome is the most severe form of the Zellweger spectrum of conditions. It is a rare…

Q: Question 12 of 13 DNA A-5 GGG GCT AGC CCC 3 ONA B-3 ATA TAT ATA TCC S ONA C-5 TAC GTT ACG TCG 3 DNA…

A: DNA is a double stranded molecule with Adenine Guanine Cytosine and Thymine as nitrogen bases bonded…

Q: What is DRESS .Give full form of this syndrome.

A: It is a type of drug induced hypersensitivity reaction, caused by certain medication.

Q: What is bio chemistry

A: The word biochemistry is the combination of two words biology and chemistry. In simple terms…

Q: What molecules do NOT participate in Citric acid cycle? нс=0 H-C-OH но-с-н н-с-он н-с-он CH2OH…

A: Citric acid cycle is a pathway, which oxidizes the acetyl group of acetyl CoA and produces CO2,…

Q: Describe in detail why the atoms surrounding the peptide bond are planar, forming the so-called…

A: Peptide bonds are the bonds that join the amino acids to form polypeptide. It is formed by…

Q: Which statement is TRUE regarding the glycolytic pathway? a. It includes five phosphate transfer…

A: The metabolic process known as glycolysis is where organisms obtain ATP energy from the breakdown of…

Q: Chemistry - Pyruvate can NOT be used to synthesize: A. Fatty acids B. Acetone C. None of the…

A: Note : Hi ! Thank you for the question. We are authorized to answer one question at a time. Since…

Q: Authophagy refers to naturally regulated mechanisms of degradation and removal of dysfunctional…

A: Denaturation is the phenomenon through which proteins or nucleic acids loses their native…

Q: Explain, which site of the heme structure, A or B, is this prosthetic group plugged into the core…

A: Myoglobin is an oxygen-binding globin protein found mainly in the muscles of almost all mammals. It…

Q: Now consider three sugars-glucose, glucuronic acid, and N-acetylglucosamine. Use shorthand (e.g.,…

A: A glycosidic bond is formed between 2 carbon atoms as the result of a dehydration reaction. The…

Q: Lactose, sucrose and maltose are: I. dimers II. isomers III. disaccharides IV.…

A: Monosaccharide- Single sugar monomer Disaccharide- Composed of 2 sugar monomers Polysaccharides-…

Q: Have a look at the results in this SDS-PAGE gel. A MW ladder is shown. In the "control" lane, a…

A: In analysis of gel electrophoresis data, the band represents qualitative data, i.e. whether the…

Q: What is it? Leading chain Ligase procedure Replication fork T structure that may participate in…

A: DNA replication is the process by which the genomic DNA is copied in cells. In this process by which…

Question

Couren betone antions
не
in which amino
exist
in
life
(9)
Lamino
(b)
D- amimo
acida
on earth n
acids
acids
meither Dor L
(d) Both
9 and I exist in life
GIVE HAND WRITTEN ANSWER
with Explantation

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

SEE SOLUTION Check out a sample Q&A here

Step 1

VIEW

Step 2

VIEW

Step 3

VIEW

Step by step

Solved in 3 steps

SEE SOLUTION Check out a sample Q&A here

Similar questions

OThe ligalon ractionf diffet zatón oPaction fouctose is that of glucose bocallse विजो exrsdrs ns o with a amine group amd q cashony hic acid > footonat) pootonute sdefaotonated grouß. a fve-membered oshg instaad of asix= membored hs depatonuta) is Foomed. a bond is Fomed to a casln Caston mstead of to a methy) opoobhated Potonated casbon A de Protonnted, Idepntonat) the caldehyde yooup mosates to a Functionelizad, de fin dinediza) Je fom dionadiza mew fositn a ketone is formed which ane of the Followrs is be associate) fouctose has 6 Caobon ipids? with in the e nhy Tnstead of 5 as is glucose Aonmo auids.
What is the sequence of the protein that would be translated from the following mRNA molecule? Use the single letter amino acid abbreviation for your answer. 5'- UGAUGUACCUCGCCUCUACGACGGAAUCCACA - 3'
1. Thennoglobin is made ap of tour polypeptides, but also requis a hane group consony nap reptes puo ednart susy sis que le des
20) The diagram represents an amino aciid. HOH Rrepresents a vanatleside chain. Winch is not a passiule salechant Crt: CH CHSCH CH CONH HOCH CHOICHO
You a ebey T Sun Cha :x BAss Syri Mic Mai Col Nu Me C In NC The M Ser w Hib Ô https://hcc.learn.minnstate.edu/d2l/Ims/quizzing/user/attempt/quiz_start_frame_auto.d21?ou3D5573459 D View Feedback Question 5 The smooth ER synthesizes The rough ER synthesizes_ Proteins, Lipids ONucleotides, Phospholipids Lysosomes, Peroxisomes Lipids, Proteins
20. clycine gre non essential amino acids O T F
Some diets suggestseverely restricting the intake of lipids. Why is it nota good idea to eliminate all lipids from the diet?
S1.What functional group (pictured below) is used in the formation of ATP, the backbone of DNA, and the plasma membrane? R. - HO- asluolom OgH 910m ansa obyd to inuoms adisi69 101 P- Hnedenoi HO 9tom anisinos H 19w 1639 eniv blut viend ou nontel:oceansied bol-ngtsl s19 1591 a. Amino b. Carbonyl c. Ester d. Phosphate e. Alcohol Sabios onime Tertio of bensemoo Insietib ti aolem tsrll blas onims ns to neg at to quang ly snodibod for ogh quotg
n 57 The sequence of amino acids in the polypeptide chain determines its final ed out of question
D Question 8 Which of the following amino acids would have a negathe value sea hyd OF ONONE of the OTHER ANSWERS PROVIDED ARE CORRECT DA OM OV 01 MANCIN
NAZO NHZ Ala-Cys-Glu -Tyr - Trp - Lys - Arg - His -Pro-G ly Glu pka 4.15 SH Tyr 10.10 Draw Charges Lys 10.67 Olt A3 12.10 +NH₂ Ntrm 2) Calculate net charge 3) write out I letter code 300 Ctim 3 juli of peptich (above) Ⓒ pH; 1,7,12
Aspirin is an acid with a pKa of 3.5; its structureincludes a carboxyl group. To be absorbed into the bloodstream,it must pass through the membrane lining the stomach and thesmall intestine. Electrically neutral molecules can pass through amembrane more easily than can charged molecules. Would youexpect more aspirin to be absorbed in the stomach, where the pHof gastric juice is about 1, or in the small intestine, where the pH isabout 6? Explain your answer.