Deoxyribonucleoside triphosphates are the necessary and fundamental monomers for polymerization of DNA. However, DNA replication also requires ribonucleoside triphosphates. Why? More than one answer is correct.  Question 8 options:   new DNA chains are initiated on an RNA primer synthesized from ribonucleoside triphosphates by primase.   DNA helicase uses the energy of ATP (a ribonucleoside triphosphate) to unwind the DNA double helix before DNA synthesis can occur.   unlike DNA polymerase epsilon, DNA polymerase delta incorporates ribonucleotides into the growing polymer to synthesize the lagging strand   ribonucleoside triphosphates are converted into deoxyribonucleoside triphosphates by DNA polymerase immediately before incorporation.   DNA is first synthesized as RNA which is converted to DNA by removal of the 2'-OH (2' hydroxyl) from the pentose sugars in the backbone by DNA polymerase.

Q: Part A Mark the location of each antibiotic's action by dragging the labels onto the diagram of a…

A: Numerous mechanisms exist by which antibiotics might affect ribosomes, the cellular machinery in…

Q: 2 What is the pathophysiology of trauma?

A: Trauma, in the context of medicine, refers to physical injuries or wounds caused by external forces.…

Q: When subculturing some fibroblast primary cell culture; you encountered a problem that the cells…

A: During the process of cell adhesion, cells interact and link with one another via specialized…

Q: 8. The physical structure that is formed when two chromatids cross over is called (A A) synaptomenal…

A: Crossing-over is the process of exchange of genetic material between non-sister chromatids of two…

Q: This graph shows the relationship between the number of individuals in a minnow school and how often…

A: The graph is about the minnow size and attacking predators. The graph shows the relationship between…

Q: In goats, a beard is produced by an autosomal allele that is dominant in males and recessive in…

A: Alleles are the alternative forms of a gene that are located on the same locus of a homologous…

Q: Explain how knowledge of the energy content of food can help dietetics make smart food choice?

A: Answer :- Knowledge of the energy content of food plays a pivotal role in the field of dietetics, as…

Q: Name Zona A Fill in the lodowing statement Dut is the movement of Osmosis BEAKER 10% BEAKER #2 CELL…

A: The process by which water (solvent) moves from higher water potential area to the lower water…

Q: Identify the following (explain in 1-3 sentences): Description: Embryonic origin : Function :…

A: All the tissues mentioned above are connective tissues and their primary function is to bind other…

Q: The genes for the human type I IFNs lack introns and those those encoding 14 subspecies of IFN-α,…

A: Genes are the part of DNA that undergoes expression and produces RNA. Eukaryotic genes contain both…

Q: Find an online image of Basidiomycota and Ascomycota Life Cycle (Asexual and Sexual Reproduction):…

A: Fungi are the unicellular Eukaryotic group of animals which are heterotrophic in nature. Their cell…

Q: Certain cells in your pancreas make digestive enzymes that are secreted into ducts and carried to…

A: The pancreas is an abdominal organ located behind the stomach, surrounded by the spleen, liver, and…

Q: Which of the following statements is TRUE about the topologies of the trees shown below?   All four…

A: A hybrid network architecture known as a tree topology, or star-bus topology, connects star networks…

Q: Describe what kind of pathological evalitations in short term in vivo test you would want to assess…

A: When performing brief in vivo safety assessments for a novel chemical designed for consumer…

Q: Select all CORRECT answer choices regarding the following question: "Which of the following are…

A: Bacteria are prokaryotic, single-celled, heterotrophic organisms. As they are heterotrophic…

Q: Which of the following result do you expect to see from your experiment, and what problem you may…

A: Immunity is the term used for the ability of our body to fight against pathogens. Immunity is of two…

Q: Cataracts develops

A: Cataracts:These are the eye conditions which are common where the natural lens of the eye becomes…

Q: Question 8 Myoglobin and the subunits of hemoglobin have: O very similar primary and tertiary…

A: Hemoglobin is an iron-containing protein, present on the surface of RBCs and carries oxygen from…

Q: What are the indications and contraindications of a bone marrow aspriate and a bone marrow biopsy.

A: Bone marrow is the soft and spongy tissue found within the cavities of certain bones, primarily the…

Q: Which of the following protein is a glycoprotein as evidenced by the provided illustration and…

A: Plasma membrane of the cells is the selective barrier and is made up of phospholipid bilayers. The…

Q: Which biome has the highest diversity of species?  A) temperate rainforest B) temperate seasonal…

A: Tropical rainforests are lush, biodiverse ecosystems found near the equator. They have high…

Q: Read the study in the picture and answer the following questions. 1. List the specific strengths and…

A: Specific Strengths of the Study:Case-Control Design: The study used a case-control approach, which…

Q: In Drosophila, the white gene located on the X chromosome affects eye color; an autosomal gene,…

A: Alleles are the alternative forms of a gene that are located on the same locus of a homologous…

Q: Answer the following in terms of genetics: 1. Why is it expected for the larger popualtions to have…

A: Genetic variation refers to the diversity in genetic traits or characteristics within a population…

Q: Which of the following levels of organization is arranged in the correct sequence from most to least…

A: Ecosystem: An ecosystem is a broader concept that encompasses both living (biotic) and non-living…

Q: An intravenous solution contains 125 mg of a drug substance in each 250 mL bottle.  It is to be…

A: To calculate how many milliliters of the solution would be given per hour, you first need to find…

Q: A set of hermaphrodite self-crosses and male x hermaphrodite crosses were established, and the…

A: A hermaphrodite is an organism that possesses both male and female reproductive organs within a…

Q: ส individual plants were collected from nature (thus not necessarily pure breeding) before flow-…

A: A single character is involved in all these crosses hence it is a monohybrid cross. In this cross…

Q: If a recombination frequency cannot be above 50%, what does it mean if two genes are, say, 60 mu…

A: Recombination is a process by which two molecules of DNA exchange pieces of their genetic material…

Q: When intracellular concentrations phosphofructokinase to be ( Main Content ats) to be OA) low, low…

A: Aerobic respiration is the process of cellular respiration in which various respiratory substrates…

Q: Bacterial cells that are longer than wider in cellular morphology, can grow in the presence or…

A: Bacteria are prokaryotic organisms that are found in diverse habitats. Based upon their requirement…

Q: CASE ANALYSIS Case: An 81 year old female brought in by her son for a medication evaluation. Her…

A: In this case, the patient is an 81-year-old female with a complicated restorative history and an…

Q: Tackle the question of how we determine membership in a particular species?

A: Definition A species is a group of organisms having similar features. A particular species has…

Q: Which of the following technique is FALSE in microscopy? Osmium tetroxide can be used as a fixative…

A: Microscopy is a scientific method employed to observe and analyze objects and structures that are…

Q: Which line represents the activation energy of the non-catalyzed reaction? Free energy L a. b. C. d.…

A: Answer : the graph which represents activation energy of non catalyst is : C) cexplaination : non…

Q: it might happen to your red blood cells if your blood solute concentration began to fall rapidly…

A: Blood performs many functions in our body. The main components of blood are red blood cell, white…

Q: ● Describe functions of pili Explain how flagellar motility and chemotaxis enable bacteria to…

A: They are prokaryotic, meaning they lack a true nucleus and membrane-bound organelles. Bacteria play…

Q: Passive transport involves the use of ________.   channel proteins only   carrier proteins only…

A: Passive transport is the movement of molecules across a cell membrane from areas of higher…

Q: 8. Which structure is indicated in this photo of a cross section through the middle of an…

A: In earthworms, the median dorsal vessel is the main circulatory structure that is responsible for…

Q: H 10 Regional Plankton Biomass W Malay 1980s 1990s Year -Middle Atlantic Bight -Georges Bank MA…

A: Gulf of Maine is one of  the most dynamic , diverse and unique environments. Frequent tides keeps on…

Q: 2. The following is the sequence of a gene encoding a small protein: GG (d) 5'…

A: Chromosome is a thread-like elongated structure that contains numerous genes on it. Genes act as…

Q: The role of allolactose in the lac operon

A: Lac Operon:This is a classic example of a gene regulation system found in E. coli.The key…

Q: PLANT VOCABULARY DOMINANT GENERATION Sporophyte/Gametophyte CELL TYPE IN ADULT ORGANISM Haploid =…

A: Coniferophyta is otherwise known as conifers. They are known for their needle-like or scale-like…

Q: Describe the process of transpiration in detail. How does water move from the roots to the leaves of…

A: Transpiration is a physiological phenomenon in which water is conveyed from the plant's roots to its…

Q: See image

A: The sequences are:AACGATGCCATCAGAGCCCAGGACGTGATTTAATTGCTACGGTAGTCTCGGGTCCTGCACTAAATT

Q: TAATTGE IGGAG anog regulatory sequence en this interaction map which DNA sequence would the…

A: Transcription regulation is a mechanism in which gene expression is regulated. For this purpose…

Q: When two inbred plants with triangular pods were crossed, the Fi plants all had ovate The resulting…

A: This is definitely a cross in which an allele apart from the main allele also determines the pod…

Q: In mammals, there are two sex chromosomes, X and Y, which behave like homologous chromosomes during…

A: To give rise to an XYY male, there must be an extra Y chromosome in the offspring's genetic makeup…

Q: In the reaction below, the products have a higher free energy (G) than the reactants What can you…

A: The thermodynamic variable known as the Gibbs free energy change, abbreviated as G (delta G),…

Q: *The normal color of snapdragons is red. Some pure lines showing variation in flower color hav been…

A: The inheritance of flower colors in snapdragons is a classic genetic study that provides insights…

Viral Replication

The virus is acellular and considered non-living outside the host cell. The replication of the virus occurs only inside the living cells. Only a few genes are present in the smallest virus, whereas many genes are present in the largest virus. These genes encode specific viral proteins.