Describe and identify on which segment of the legs/limbs of an insect would you expect the ambulatorial, fossorial, grasping, natatorial and raptorial type of legs/limbs be located?
Q: In a three-point testcross the nonrecombinant progeny are A+B+ C+ and a b c. The double crossover pr...
A: Three point cross refers to usinh three genes to determine order and distance between genes. During ...
Q: Look for an ecosystem in local setting which shows an inverted pyramid. Is this possible in an ecosy...
A: Yes, inverted pyramid is possible in ecosystem. There are many examples like pyramid of biomass in a...
Q: Enumerate clinically relevant parasites that can be visualized using the Kato-Katz method in a clini...
A: The most prevalent method of gastrointestinal infection is the contamination of water, food, and han...
Q: Refer to the accompanying figure to answer the following question(s). R R EN-C-C-N-C-C-O-H H H А. В....
A: Q. At which bond would water need to be added to achieve hydrolysis of the peptide, back to its comp...
Q: An Hfr strain of E. coli that is pro thr * leu * lac " was "mated" with an F- strain that is pro thr...
A: Introduction Genetic recombination is a process of exchange of genetic material between two differen...
Q: hybridization production of antibiotics vaccine development transgenic animals transgenic plants pro...
A: Recombinant DNA technology(RDT) is widely used in plant tissue culture, animal cell culture,medicine...
Q: All of the following are true about diffusion EXCEPT: a) Higher temperatures decrease the rate of di...
A: Diffusion is the passive movement of molecules or particles (for example, atoms, ions, molecules, en...
Q: A crude extract sample was obtained from a plant and was found effective as an anti-diabetic agent i...
A: Therapeutic index or TI = LD50/ED50 TI basically suggests the relative safety. Now, by putting the v...
Q: Translate this RNA transcript: 5' - UUUCUUAUGUGUCGCCGUAAUUGAUAUUAC - 3'. O Phe-Leu-Met-Cys-Arg-Arg-I...
A: Note: As per Bartleby Guidelines For Remaining Answers Please Repost The Question. Introduction: Tra...
Q: If p = .5, calculate q, p^2, 2pq, q^2. Select all the answer below that are correct. Note p2 and p^2...
A: Here given, p= 0.5 According to Hardy Weinberg Equilibrium, We know that : p+q= 1 If p= 0.5 then q=...
Q: What are the sources of gums and mucilages found in the Philippines? Tabulate 10 sources of these th...
A: Gums and mucilages are produced by plants. Both on hydrolysis yield sugar and uronic acids. Mucilage...
Q: A B • Structure A [ Select] • Structure B [ Select] [ Select ] • Structure C is part of the endoskel...
A: A - is the stomach.( Star fish consists of 2 stomach the cardiac stomach and the pyloric stomach. B-...
Q: Explain Biochemical Evidences. How can it support evolution
A: Introduction :- In biology, evolution refers to the change in a species' features over numerous gene...
Q: You crossed tall pea plants to another tall pea plants. You collected all the seeds and planted them...
A: Mendel selected pea plants to investigate genetics because they had clearly recognizable characteris...
Q: which climate related factors shape biomes and how might they affect which organisms live in a parti...
A: ANSWER;- Climate includes temperature and precipitation, and it decides the developing season and so...
Q: Animal Kingdom Do not possess a backbone Possess a backbone Asymmetric, Bilateral symmetry, does not...
A:
Q: Fig. 5: LAPTM5 transports HIV-1 Env to the lysosome for degradation. a 120, x43 x 137 x146 NL4-3 Vpr...
A: "ANSWER By causing damage to HIV-1 Env, LAPTM5 transports it to the lysosome. With Vpr-defective H...
Q: How is a knowledge on the origin of the insect alimentary canal assists one in understanding each di...
A:
Q: Discuss how the transcending functions are associated with the integrative levels of organization in...
A: The levels-of-organization approach is used to help people comprehend and discover biological, ecolo...
Q: The _ is the region that triggers hunger in response to signals from nerve cells and messages carrie...
A: Hypothalamus Its forms the lower or ventral part of diencephalon. It lies at the base part thalamus...
Q: Who would you expect to have the most frequent sex and the most satisfying sex, hook-up couples or c...
A: Reproduction ensures the continuity of species on earth. But it is not necessary for survival. Throu...
Q: In cyclic photophosphorylation, an electron in P700 is excited by a photon and begins to taking the ...
A: The light reaction of photosynthesis involves production of ATP and NADPH by using sunlight. In this...
Q: Sexual adjustment is best viewed as a relationship issue, not just one partner’s problem. T or F?
A: Human beings are social animals. The first man on Earth was a cave man. No societal rules and regula...
Q: how the regulation of DNA expression by the proteins that are bound to it and their inheritance infl...
A:
Q: Fig. 1: Vpr counteracts LAPTM5 to promote HIV-1 infection in macrophages.
A: Vpr is the accessory protein of HIV-1 that reinforce the infection in macrophages and LAPTM5 (lysoso...
Q: Describe the smaller and largest living unit of Ground Tissue System
A: The plants are made up of two structural systems: the shoot system and root system whereas the shoot...
Q: What's the role of Protein Phosphatase 1 (PP1) in cell signaling?
A: Protein phosphatase 1 (PP1) belongs to the protein serine/threonine phosphatases family of phosphata...
Q: In this process of enzyme inhibition, a molecule binds to a site on the enzyme that is NOT the activ...
A: An enzyme inhibitor are molecules that interrupt or decreases the rate of an enzyme catalyzed reacti...
Q: H,0 H,0 H,0 H,0 H,0 Plasma membrane H,0 Which figure depicts an animal cell placed in a solution hyp...
A: Hypotonic solution: A solution with less dissolved particles (salt and other ions) than ordinary cel...
Q: Which one of the following does NOT describe good scientific writing? O Accurate Brief Concise O Det...
A: INTRODUCTION Scientific writing It is a type of writing that is designed to communicate scientific i...
Q: What is genetic disorders? Explain by giving an example.
A: Genetics is described as the branch of biology that focuses on the study of genes, their inheritance...
Q: the gene order for three linked genes being studied is A B C. The number of recombinants resulting f...
A:
Q: How would a mutation in the poly(A)-binding protein gene affect translation? How would an electron m...
A: Restriction digestion analysis of any band that is subjected to the process of reverse transcription...
Q: How is knowledge on the origin of the insect alimentary canal assist one in understanding each div...
A:
Q: Which scientific name below is correctly written and follows all the rules of binomial nomenclature?
A: In scientific writing, common names are rarely used. The Latin binomial i.e. scientific name is us...
Q: An individual whose genotype is AABbCc is crossed with an individual who is heterozygous for all thr...
A: Gamete being an organism's reproductive cell, is a haploid cell which contains only one set of diss...
Q: analysis of eukaryotic cells and how they differ from prokaryotic cells.
A: Eukaryotic cells include plant cells and animal cells and they differ from each other by the presenc...
Q: Flg. 1. Breast cancer families 1 to 7. Solid circles, females with breast cancer; open circles, fe- ...
A: Solution:- We are given the following probabilities:P(woman will develop breast cancer gene) = 1/10P...
Q: Part 1: Identify the haploid and diploid generations of the following plants. (Examples are found in...
A: Ans) ✓Life cycle of bryophytes The life cycle of bryophytes consists of an alternation of two stages...
Q: Explain your answers with supporting details. 1. Compare the concepts of Gender, Sex and Sexualit...
A: Answer 1- Gender is the collection of qualities that define femininity and masculinity and serve to ...
Q: Please answer fast In a population of rats on an island, fur color is determined by one allele wher...
A: All cellular organisms are made of cells. Cells are the basic building blocks of life. Cells contain...
Q: ENUMERATE. The capabilities as a swimmer or capabilities to become a good swimmer?
A: Swimming is indeed an useful and enjoyable way to remain in shape. It has numerous health benefits, ...
Q: Discuss the role of the regulator in relation with DNA damage and recombination in the article histo...
A: Candida glabrata, is species of haploid yeast, it is a nosocomial fungal bloodstream pathogen, thi...
Q: Explain the level of greenhouse gases in the atmosphere and its impacts in environments with a neat ...
A: Green house effect It is the phenomena where earth surface get heated. It is a natural process. when...
Q: Describe Brownian motion. What causes it? How does one differentiate between Brownian motion, water ...
A: Brownian motion or movement is that the uncontrolled movement of particles or zigzag pattern of move...
Q: In dihybrid crossing, are the two genes that code for the two separate phenotypes on the same chromo...
A: Inheritance or heredity is passing-on one trait from the parents to the progeny by either asexual or...
Q: upper motor neurons: lower motor neurons
A: Answer- option D- UPPER MOTOR NEURONES AND LOWER MOTOR NEURONES.
Q: ) Does the fossil record indicate that life first appeared in the water or on the land? ...
A: Fossils are the preserved remains of plants and animals whose bodies were buried in sediments. like ...
Q: 1. In a three-point testcross, the nonrecombinant progeny are A* B* C* and a b c. The double- crosso...
A: Q. In a three-point testcross the nonrecombinant progeny are A+B+ C+ and a b c. The double crossover...
Q: How does modification of the insect legs/limbs better equip the insect to survive in a given environ...
A: Insects are adapted their environment in many ways. An adaptation is an adjustment to the environmen...
Describe and identify on which segment of the legs/limbs of an insect would you expect the ambulatorial, fossorial, grasping, natatorial and raptorial type of legs/limbs be located?
Trending now
This is a popular solution!
Step by step
Solved in 2 steps
- Elaborate and explain thoroughy: How does modification of the insect legs/limbs better equip the insect to survive in a given environment? b) Describe and identify on which segment of the legs/limbs would you expect the ambulatorial, fossorial,grasping, natatorial and raptorial type of legs/limbs be located?How does modification of the insect legs/limbs better equip the insect to survive in a given environment? Describe and identify on which segment of the legs/limbs would you expect the ambulatorial, fossorial, grasping, natatorial and raptorial type of legs/limbs be located?Question about insects: b) Describe and identify on which segment of the legs/limbs would you expect the ambulatorial, fossorial, grasping, natatorial and raptorial type of legs/limbs be located?
- What are various podomeres that make walking legs of the insects? Explain brieflyWhat segment of the grasshopper, a typical insect, contains the legs? What segment of the lobster, a typical crustacean, contains the legs?when observing earthworms, while they move, can you easily distinguish the anterior from the posterior end? Yes, you can! If they are not moving, can you see any distinguishing feature in the body segments that may enable you to identify the anterior from the posterior?
- Insect cuticle is the characteristic feature of class insecta and is to a large extent responsible for the success of insects as terrestrial animals. Write down a detail note on the insect Body wall, integument and exoskeleton.What are the similarities and differences in each part of the forelimb of a moth, Pteradactyl, bird and batFor each of the following classes of Arthropods, identify a feature unique to the class and at least 2 organisms that belong to the class: Insecta Crustacea Chelicerata Diplopoda 2. State the function of the following parts of the genus Romalea (grasshopper): antenna, tympanum, spiracles, ovipositor (female), gastric caeca, malphigian tubules, tracheae, air sacs .