Digestion of cellobiose in cows produces two glucose units which is then absorbed into the bloodand distributed into the cells for energy production. One glucose unit is catabolized in the muscle cellwhile the other is in the heart cell, to CO2 and H2O in the cellular respiration process. How many ATPmolecules are released? Show your detailed answer / computation
Q: 8) Consider the tetrasaccharide stachyose drawn below. Stachyose is found in white jasmine,…
A: Stachyose is a tetrasaccharide consisting of two D-galactose units, one D-glucose unit, and one…
Q: Which of the following molecules is most susceptible to random hydrolysis? OA. None of these; all of…
A: Random hydrolysis, the non-specific cleavage of bonds by water molecules, can affect different…
Q: All of the following are accurate contrasts for beta oxidation vs fatty acid synthesis except which…
A: In both beta-oxidation and fatty acid synthesis, the hydroxylacyl group retains the same…
Q: Calculate the percent error for pipette P1000.
A: The pipette is designed to dispense a specific volume of liquid, in this case 1000 microliters (uL).…
Q: Under low tryptophanyl-tRNA (tRNAtrp), we expect the trp operon to be expressed because: Question…
A: Trp operon functioning in the bacterial system Escherichia coli consists of a set of genes that…
Q: With the advent of photosynthesis, the amount of oxygen in the atmosphere has varied over the eons…
A: Approach to solving the question:Detailed explanation:Examples:ANSWER IS 12 ML H20 Key references:…
Q: QUESTION 5 Carbohydrates supply which element for the construction of other biomolecules? carbon…
A: Carbohydrates supply the element carbon for the construction of other biomolecules. Carbon is a…
Q: Please help me fill out this worksheet
A:
Q: Please help me fill out the boxes in this assignment
A: Approach to solving the question: Detailed explanation: Examples: Key references:
Q: 48. A 58-year-old woman comes to the office because of a 1-month history of fatigue, fever,…
A: The objective of the question is to identify the cell type that is most likely being directly…
Q: Corona virus tes with a 5% false positive rate and a Corona virus infection rate of 5% in Canada, if…
A: The objective of the question is to calculate the probability that a person who tests positive for…
Q: Knowing that liquid liquid phase separation will occur when the change of gibbs free energy of the…
A: Inducing Liquid-Liquid Phase Separation (LLPS) in Cells-Liquid-liquid phase separation (LLPS) relies…
Q: 1. Draw the structure of an omega-3 fatty acid, docosahexaenoic acid (DHA, 22:6 (4,7, 10, 13, 16,…
A: The structural formula of DHA can be represented as follows:CH3 - CH2 - CH = CH - CH2 - CH = CH -…
Q: Reverse translate the sequence of insulin pasted…
A: To reverse translate the given sequence of insulin and optimize the codons for Homo sapiens and…
Q: At what pH does Aspartate have a net charge of -1 (negative 1)? For Aspartate, the pKa of the alpha…
A: we need to consider the pKa values and determine at what pH Aspartate has a net charge of -1. The…
Q: d. e. fo HO -OH NH2 n blood HO n H3C SCOA OH HO NH CH3
A: Reactions mechanisms are basically jumping of electrons within and between the reactants. Based on…
Q: Imagine the main chain of a protein bends back on itself, so that two amino acid residues R, and R,…
A: Salt bridge is a bond between amino acids which carry opposite charges. The opposite charges exert…
Q: Please help me fill out the boxes in the worksheet
A: The image represents a simplified overview of several interconnected metabolic pathways, including…
Q: A student performed an enzyme inhibition reaction to experimentally determine the inhibitor constant…
A: The Dixon plot is a graphical method used in enzyme kinetics to determine the inhibition constant of…
Q: A partial diploid in E. coli is created so that LacI is no longer expressed from the genome and is…
A: Partial diploid E.coli has both chromosomal DNA (i.e. genome) and plasmid DNA, but all the genes are…
Q: 7 Monomeric protein A reacts with an excess of 2-mercaptoethanol and gives protein B. The latter…
A: Certainly! Let's discuss the queries pertaining to the provided protein structures and reactions:…
Q: To oxidize the fatty acid molecule shown below, what enzyme(s) are needed in addition to the enzymes…
A: Fatty acids are carboxylic acids with a hydrocarbon chain ranging from 4 carbon to 36 carbons.…
Q: 5'-AATGCCTCAGCCGATCTGCCTCGAGTCAATCGA TGCTGGTAACTTGGGGTATAAAGCTTACCCATGGTATCGTAG…
A: PCR is a lab technique used for amplification of target DNA sequence by using a thermostable DNA…
Q: Tryphtophan is an essential amino acid that is used in the biosynthesis of proteins. Its molecular…
A: Amino acids are biomolecules that have a hydrogen atom, a carboxyl group, an amino group and a…
Q: In bacteria, what is the role of the Shine-Dalgarno sequence? Question 3 options: It binds to…
A: The Shine-Dalgarno sequenceRibosomal binding site in mRNA.It enables initiation of protein synthesis…
Q: Based on their fat content, which is the healthier option? Explain your answer. - Based on all of…
A: Unsaturated fatty acids in nature have doube bonds in cis configuration. Vegetable oils have a high…
Q: Vmax Km x10 TOOLS
A: Vmax and Km are the two important parameters in enzyme kinetics.Vmax is the maximum rate of an…
Q: While fatty acids longer than 20 carbons are rarely found in foods, lignoceric acid (24:0) is found…
A: Liganoceric acid (24:0) metabolism entails a number of crucial processes that lead to the production…
Q: Model 2: Reactions of carboxylic acids and esters (3) (4) + H₂O OH (5) OH (6) 'OR' OR' + H3O® + NaOH…
A: Answer (5) Reaction number 4 in model 2 is acid base reaction Explanation:Step 1: Step 2:Step 3:…
Q: MATCH a structure or term from the following list with each description below. Place the letter of…
A: 1. The reactive electrophile in Friedel-Crafts acylation reactions (R3C⁺): In Friedel-Crafts…
Q: In the TCA cycle, carbon enters the cycle as metabolic energy captured as a. and malonate, water,…
A: a) Incorrect. Malonate is not the entry point for the TCA cycle. The correct entry point is…
Q: MAKE A GRAPH FOR ME ON GRAPH PAPER CALL IT ENZYMES VS RATE OF REACTION USING TABLE BELOW GRAPH RUES…
A: Data Points and PlottingThe graph I created is a scatter plot that displays values from two…
Q: Derivatives of purines and pyrimidines make up the base component of nucleotides. Н HCG 6 N 5 7…
A: Deoxyribonucleic acid (DNA) is a molecule that is present in all known living things as well as many…
Q: You have a crude lysate sample (CL) containing a mixture of six proteins (1, 2, 3, 4, 5, ẞ-…
A: Proteins precipitate at specific concentrations of various salts. The concentration of salt required…
Q: 2. What is the major organic product obtained from the following reaction? CH3 Brz FeBr3 CH₂Br CH3…
A: Step 1:
Q: You will have to dilute your inital Lysozyme stock in order to pipet volumes larger than 10 uL for…
A: Step 1:For the Bradford assay, the typical concentration range of protein you want to target is…
Q: 1.(a) ( ) Trace the course of [1,6-(C-14)-2,5-(C-13)]glucose that is first processed through…
A: Here is a sample illustration of the described pathway above: To summarize, after glycolysis,…
Q: 3. (a) ( The equilibria for release of molecular dioxygen (O2) and protons (H+) by human hemo-…
A: See below sectionExplanation:Detailed explanation:a): The image you provided illustrates a chemical…
Q: Genomic sequencing cannot be used to: Predict a protein coding gene Predict structure and function…
A: Genomic sequencing can be used for tasks such as predicting protein-coding genes, analyzing protein…
Q: In addition to euchromatin and general transcription factors, initiation of transcription in humans…
A: The answer is 5-methylcytosine; proximal promoter but not distal promoterExplanation:Transcription…
Q: What is the major organic product obtained from the following reaction? OH OH OH OH 1. NaOH, H₂O 2.…
A:
Q: No hand writingPlease draw out a mechanism thank you so much!
A: Step 1: Step 2: Step 3: Step 4:
Q: Consider the reaction below to answer the following question(s): + HBr A B Br с + D Br Enter the…
A: The kinetically controlled product is DOption 1 is correctExplanation:
Q: What makes photorespiration disadvantageous regarding crop yields?
A: "Since you have posted multiple questions, we will provide the solution only to the first question…
Q: Which of the following statements accurately describes differences in beta oxidation vs fatty acid…
A: The objective of the question is to identify the accurate statements that describe the differences…
Q: 3. (a) The activity of the Pentose Phosphate Pathway is commonly quantified by measuring 14CO2…
A: (a)In the Pentose Phosphate Pathway (PPP), the radioactive isotopomer of glucose that releases 14CO2…
Q: Compare and contrast mitosis and meiosis by filling up the table below
A: Cell division involves mitosis and meiosis, which are two distinct processes. Despite sharing some…
Q: Please help me fill in all the information
A: 1. **Conversion of Pyruvate to Acetyl-CoA**: - **Pyruvate Dehydrogenase Complex**: This complex of…
Q: Extension Questions Which of the following sequences correctly represents the flow of electrons…
A: Extension questions •The correct sequence representing the flow of electrons during photosynthesis…
Q: 12. What is the major organic product obtained from the following reaction? OCH 3 Br2 CH3CO₂H Br 1 2…
A: This is reaction undergo electrophilic aromatic substitution. Electrophilic aromatic substitution is…
and distributed into the cells for energy production. One glucose unit is catabolized in the muscle cell
while the other is in the heart cell, to CO2 and H2O in the
molecules are released? Show your detailed answer / computation
Step by step
Solved in 2 steps
- Digestion of cellobiose in cows produces two glucose units which is then absorbed into the bloodand distributed into the cells for energy production. One glucose unit is catabolized in the muscle cellwhile the other is in the heart cell, to CO2 and H2O in the cellular respiration process. How many ATPmolecules are released? Please show your detailed computation.Digestion of cellobiose in cows produces two glucose units which is then absorbed into the blood and distributed into the cells for energy production. One glucose unit is catabolized in the muscle cell while the other is in the heart cell, to CO2 and H2O in the cellular respiration process. How many ATP molecules are released? Show your detailed computation.Digestion of cellobiose in cows produces two glucose units which is then absorbed into the bloodand distributed into the cells for energy production. One glucose unit is catabolized in the muscle cellwhile the other is in the heart cell, to CO2 and H2O in the cellular respiration process. How many ATPmolecules are released? Show your detailed computation. answer.
- Digestion of cellobiose in cows produces two glucose units which is then absorbed into the bloodand distributed into the cells for energy production. One glucose unit is catabolized in the muscle cellwhile the other is in the heart cell, to CO2 and H2O in the cellular respiration process. How many ATPmolecules are released? Show your detailed computation of the problem.Digestion of cellobiose in cows produces two glucose units which is then absorbed into the bloodand distributed into the cells for energy production. One glucose unit is catabolized in the muscle cellwhile the other is in the heart cell, to CO2 and H2O in the cellular respiration process. How many ATP molecules are released? Show your detailed computation of the problem.An animal cell, roughly cubical in shape with side length of 10 μm, uses 109 ATP molecules every minute. assume that the cell replaces this ATP by the oxidation of glucose according to the overall reaction 6O2 + C6H12O6 →6CO2 + 6H2O and that complete oxidation of each glucose molecule produces 30 ATP molecules. how much oxygen does the cell consume every minute? How long will it take before the cell has used up an amount of oxygen gas equal to its own volume?
- The average cell, at rest, hydrolyzes 10,000, 000 ATP molecules per second. You are studying the stem cell population found in the intestinal Crypts. In the intestine there are s total 5 x 1011 cell number. The stem cells have a 85% higher metabolism than an average resting cell. ATP hydrolysis yield 7.4 kCal/ Mole ATP. (Avogadro’s number is 6.023 x 1023) 2) How many Kcal of energy are used per day by this population of cells? A) 4.514 kCal/day B) 1.14 x 10-6 kCal/day C) 1.14 x 10-4 kCal/day D) 25 kCal/day E) 225 kCalStearic acid is an 18-carbon fatty acid. If a single molecular of stearic acid is within the cytosol of the cells: Describe the process by which stearic acid would be metabolised, beginning the molecule in the cytosol of the cell, ending with the creation of ATP, and assuming the cell has sufficient oxygen for all reactions to take place Showing all working, calculate how many ATP molecules could be generated from a single molecule of stearic acid in the cytosol of the cellThe average cell, at rest, hydrolyzes 10,000, 000 ATP molecules per second. You are studying the stem cell population found in the intestinal Crypts. In the intestine there are s total 5 x 1011 cell number. The stem cells have a 85% higher metabolism than an average resting cell. ATP hydrolysis yield 7.4 kCal/ Mole ATP. (Avogadro’s number is 6.023 x 1023) Assuming 32 ATP per glucose oxidative metabolically, how many moles of glucose are consumed per day? A) 12,000 mole of glucose/ day B) 1.14 mole of glucose/ day C) 1.14 x 10-7 mole of glucose/ day D) 4.9 x 10-7 mole of glucose/ day E) 225 mole of glucose/ day F) 3.8 x 10-14 mole of glucose/ day Please explain how to do this!!!
- The concentration of glucose in your circulatory system is maintained near 5.0 mM by the actions of the pancreatic hormones glucagon and insulin. Glucose is imported into cells by protein transporters that are highly specific for binding glucose. Inside the liver cells the imported glucose is rapidly phosphorylated to give glucose-6-phosphate (G-6-P). This is an ATP-dependent process that consumes 1 mol ATP per mol of glucose. Given the steady-state intracellular concentrations below, calculate the theoretical maximum concentration of G-6-P inside a liver cell at 37 °C, pH = 7.2 when the glucose concentration outside the cell (i.e., [glucoseloutside) is 5.0 mM: ATP = 4.7 mM; ADP = 0.15 mM; P, = 6.1 mM For: ATP + H,O ADP + P + H* AG" = -30.5 kJ/mol and G-6-P + H,0 -→ Glucose + P AG" = -13.8 kJ/mol The glucose phosphorylation reaction is ATP + glucosenside » ADP + glucose-6-phosphate + H+The average cell, at rest, hydrolyzes 10,000, 000 ATP molecules per second. You are studying the stem cell population found in the intestinal Crypts. In the intestine there are s total 5 x 1011 cell number. The stem cells have a 85% higher metabolism than an average resting cell. ATP hydrolysis yield 7.4 kCal/ Mole ATP. (Avogadro’s number is 6.023 x 1023) 1) How many moles of ATP are hydrolyzed per second? A) 15.3 moles/ sec. B) 7.06 x 10-6 moles/ sec. C) 5.4 x 10-2 moles/ sec. D) 25 moles/ sec. E) 225 moles/hour F) none of thesePlease, please, please solve the question in 10 minutes Under fed-condition, heart muscle prefers... fatty acids/glucose Oglucose/fatty acids Oketone bodies/ glucose Oglucose/ketone bodies as fuel, whereas skelet What is the order of hydrogen transport in mitochondrial electron transport system (respiratory chain), if the origin of hydrogen atoms (electrons) is NADH+H*? O Complex -> Coenzyme Q --> Complex II --> Complex III --> Cyt c-> Complex IV-> 02 O Complex -> Complex II -> Coenzyme Q-> Complex III --> Cyt c --> Complex IV -> O₂ O Complex -> Coenzyme Q --> Complex III --> Cyt c-> Complex IV --> O₂ O Complex II --> Coenzyme Q--> Complex III --> Cyt c --> Complex IV --> 0₂
