Q: Mate two flies. a male is a wild type and a female has yellow body and purple eyes.
A: As you asked many questions here I'm giving answer's of 3 questions Rest please repost…
Q: Wild ungulates water depedency.
A: * wild ungulates respond to seasonal changes in temperature and precipitation by behavioural…
Q: Explain the positive and negative results of ELISA.
A: Introduction ELISA is an acronym for enzyme-linked immunoassay. Antibodies in the blood are detected…
Q: Explain the significance of satellite DNA in DNA profiling technique
A: Deoxyribonucleic acid or DNA is a polymer composed of two polynucleotide chains that coil around…
Q: formation of different cellular phenotypes is due to the equal distribution of the cytoplasmic…
A: Phenotype shows the appearance of individual. genotypes shows the genetic type.
Q: After several rounds of replication, if COVID19 RNA changes from 5’ GGGUACAUGGUAGCCCCCGUCGAG …. 3’…
A: Mutations are sudden heritable changes in the genetic makeup of the cells which lead to altered…
Q: All the following are considered acute phase response proteins except: O CRP O Mannose binding…
A: Introduction :- The acute phase response is triggered by an overwhelming immune-inflammatory…
Q: Describe the processes of cellular signaling and metabolism that are altered during the…
A: Metabolism is defined as the entire quantity of biochemical events that occur in an organism's cells…
Q: 3. Chronic alcoholism damages the liver. In people who have alcohol-induced liver damage, the blood…
A: Introduction Excess fluid trapped in your body's tissues causes edoema, which causes swelling.
Q: What Characteristics of Phosphorous minerals makes them suitable to be used as fertilizers?
A: Most common form of phosphorus is Diammonium phosphate and monammonium phosphate,NPK etc. NPKs is a…
Q: I. Individuals diagnosed with autism can have reduced expression of the oxytocin gene due to…
A: The majority of mutations develop when the DNA fails to duplicate correctly. All of these mutations…
Q: In the series "Lost" 20 individuals crashed on a deserted island. One of the many alternate…
A: The given situation is an ideal situation of the Hardy Weinberg Equilibrium. As per the data…
Q: association of 2alpha and 2 beta chains to form adult hemoglobin identify which describes the…
A: Translation is process of conversion of RNA to protein.
Q: Identify what is being described by each of the following statements. Write your best answer on the…
A: Evolutionary studies Evolution is the change in characteristics over time to survive and reproduce…
Q: Arrange the following list into the correct sequence for viral reproduction: 1. penetration 2.…
A:
Q: biocatalyst pre-treatment required for biohydrogen production? If yes, then explain any two…
A: Biohydrogen production The biological production of hydrogen is referred to as biohydrogen. Since…
Q: 1. Which of the following Pseudomonas aeruginosa virulence factors has a mechanism of action similar…
A: *NOTE: Kindly repost for other questions Dear Student as per the guidelines we are supposed to…
Q: Icefish live in the extremely c They are the only vertebrates bin. They have a large heart a their…
A: A new study has discovered a concerning link between warmer seas, declining sea ice levels, and…
Q: What are the monoclonal antibodies: a) antibodies produced in one animal; b) antibodies delivered in…
A: Antibodies are specialised Y shape proteins that binds to the foreign invaders -whether they are…
Q: Assuming that these are the 12 microplates. What is wrong with the result of the test? What do you…
A: There are few important points : ELISA : Enzyme linked immuno sorbent assay is used in diagnosing…
Q: You are studying a potential case of incipient sympatric speciation involving two morphs of a…
A: First of all, let's look what sympatric speciation is. Sympatric speciation is a type of speciation…
Q: does a positive or negative interference reduce the distance between two loci
A: Genetic interference is, a phenomenon where the occurrence of one crossover inhibits or increases…
Q: Both statements are false. I. Adding acetyl groups in the histone tail restricts access to genes.…
A: Introduction:- Histones: In chromosomes, there is a type of protein called chromosomal protein.…
Q: Arrange the groups in order in which they evolved. ___ 1 (earliest) a. Jawless fishes ___…
A: The marine ecosystem is defined as the largest aquatic environment with high levels of salt in the…
Q: 4.Why does the right ventricle need to pump the blood to the lungs via the left and right pulmonary…
A: Heart is muscular pumping structure which is used to supply oxygen rich blood to all parts of body.…
Q: This condition is characterized by underdevelopment of the brain which can result from insufficient…
A: Introduction :- Spina bifida is a birth defect caused by improper development of the spine and…
Q: times exercise intensity may be measured by all of the following except: xygen consumption eart rate…
A: Exercises makes a lot of changes inside the body. It makes changes in the way the heart beats and…
Q: AB blood marries a man heterozygous for Type B blood. Their children could have each of these blood…
A: Woman have blood group AB so having alleles IAIB and man is heterozygous for B blood group so allele…
Q: oxytocin gene due to methylation. II. Mice with hypermethylation of the agouti gene became obese and…
A: Membrane fracturing, physical or pharmacological opening of the cervix, and oxytocin injection,…
Q: Explain how Frederick Griffith's experiment discovered the transforming principle.
A: The bacteria from the III-S strain were destroyed by heat, and the rest were combined with bacteria…
Q: PRDM9 recruits SPO11, a topoisomerase type II like protein, to induce DNA double strand breaks.…
A: Introduction PRDM9 is a DNA binding and zinc finger protein that trimethylates histone H3K4…
Q: How does the forelimb grow differently than the hindlimb? How can limb size be so precisely…
A: Introduction During the development of vertebrate limbs, the limb bud is formed. It occurs during…
Q: 13.Which is NOT an example of innate defense? 13.Which is NOT an example of innate defense? Note:…
A: Immunity is a phenomenon which helps an organisms to fight against the harmful pathogens so that…
Q: major cause of septic shock is the presence of lipopolysaccharide (LPS) from bacteria in the blood.…
A: Septic shock has high modidity and mortality rate due to its effect on circulation in the body which…
Q: Can you curl your tongue? Tongue-curling in humans (T) is a dominant genetic trait. Derek can curl…
A: Introduction Each parent gives each child two copies of each gene, known as alleles. If a gene's…
Q: newborn rats that were groomed na dlicked by their mothers grow calmer compared to their unnurtured…
A: When a rat mother is devoted to her offspring, the GR gene in the pups progressively demethylates,…
Q: 9. Some biologists contend that the term double fertilization is a misnomer and that the process…
A: Fertlizatiion is the process of the male gamete, sperm, fusing with the female gamete, the ovum,…
Q: Which of the following diet-derived compounds have epigenetic effects? O folic acid O vitamin B12…
A: ANSWER;- Folic acid Explain;- Folate, along with other B-nutrients, assumes an urgent part in the…
Q: How many μ moles of acetaldehyde are required to allow complete oxidation of the pyruvate to 15µ…
A: the limited supply of NAD+ will deplete the reaction initially causing the reaction to stop, but…
Q: What are the selective attributes and criteria used for the selection of algae strains with…
A: *Algae strains will be used mostly for production of renewable energy like biofuel * The main…
Q: Arrange the statements in their proper order by writing the corresponding letter (e.g. A) for each…
A: mRNAs contain a transcribed copy of the DNA sequence with a terminal 5′-triphosphate group and a…
Q: prit bris Smooth bori x beasd Wrinkled Smooth X Smooth Smooth Smooth Smooth Wrinkled 14. Based on…
A:
Q: Describe the reproductive cycle of a retrovirus, such as human immunodeficiency virus (HIV).
A: Introduction Viral infections are very harmful to mankind. In the post century where we faced the…
Q: RNAi (or RNA interference) is the process of creating double-stranded RNA in the cells. Explain how…
A: * RNA interference (RNAi) also called as Post Transcriptional Gene Silencing whi h is an conserved…
Q: 1. Length of fur is also genetically determined. The allele L produces long fur and its…
A: * Given that Length of fur is Genetically determined. *The allele L produce long fur and another…
Q: Controlling for body size, would you expect a flightlessbird to produce eggs that are larger than,…
A: Flightless birds are birds that are unable to fly. These animals, which evolved from flying…
Q: 3.Histamine is a signaling molecule that plays a significant role in regulating immune responses…
A: Histamine is a nitrogenous organic molecule that has a role in local immunological responses, as…
Q: Bacterial DNA will be recognized by innate immune cells though binding to: O TLR8 O TLR9 TLR2 TLR4
A: Innate Immunity: Immunity that is innate, or nonspecific, is a protective system that you were born…
Q: functional insulin required the association of two polypeptides known as the A and B chains…
A: Pre transcription control involves in DNA methylation. Transcriptional control involves in…
Q: Please answer fast and all other wise I will give downvote. 1. Memory T cells in circulation tend…
A: All these questions are related to components of the immune system which are studied in a branch of…
Discuss the link between the exponential growth of tumors and tumor metastasis and how these are influenced by cancer chemotherapy.
Trending now
This is a popular solution!
Step by step
Solved in 2 steps
- The most common therapeutic approaches to treating cancer include all of the following except ________. a. chemotherapy b. irradiation of tumors c. surgery to remove cancerous tissue d. administering doses of vitaminsDiscuss the purpose and role of the various treatment modalities in the management of cancerDiscuss the clinical significance of tumor markers
- The following are drugs that act as anti-tumor agents and are often used as part ofchemotherapeutic regimens for cancer patients. Explain how the use of the following drugs mayprevent cancer cell growth and/or proliferation.Name the six fundamental properties of malignant tumours. Which of these properties are amenable to study in a cell culture model of cancer and why?Briefly summarize the conventional wisdom (DNA mutation theory) of the cause of cancer. Discuss the treatments and side effects of these treatments that are based on the DNA mutation theory.
- Discuss the challenges of producing anticancer drugs that counteract the effects of mutations in tumor-suppressor genes.name any two methods that can possibly cure cancer .For many years, targeted therapies for cancer treatment continue to be developed, however more and more patients are developing resistance to targeted therapies. Discuss one mechanism of resistance to targeted therapies for cancer and provide an example of how might creatively combat it using clinical concepts.
- Explain several ways by which the treatment of cancer by chemotherapy may temporarily create additional health problems for the patient.Discuss why cancer treatment may involve a combinationof chemotherapy, radiation therapy, and surgery.Discuss how growth factors influence cell signaling and proliferation that leads to cancer induction, progression, and metastasis. Be sure to include the involvement of apoptosis and angiogenesis.