DNA primase synthesizes a short RNA primer that later appears at the 5'-end of each Okazaki fragment.
Q: The linking of the 5’ end of one Okazaki fragment with the 3’ end of an adjacent Okazaki fragment…
A: The DNA is the genetic material that is passed from one generation to the next generation. It is…
Q: Transposable elements are short segments of DNA, presentin ___________ locations, that move around…
A: Introduction Transposons are the short highly repeated DNA sequence present in heterochromatic…
Q: 8-oxo-G base in genomic DNA is often produced by and may be repaired by
A: 8-oxoguanine or 8-oxo-G is formed by the oxidation of a guanine base in DNA. It is widely…
Q: Why isn’t cDNA synthetic
A: INTRODUCTION Deoxyribonucleic Acid, or DNA, is a molecule that holds the instructions that an…
Q: The function of transposase isa. to recognize inverted repeats.b. to remove a TE from its original…
A: A gene is a specific sequence of nucleotides in RNA or DNA that is located usually on a chromosome.…
Q: What is the importance of the 3' to5' exonucleasevactivity of DNA polymerase
A: Enzymes serve as biological catalysts that fasten the rate of reaction by lowering the activation…
Q: The following sequence has been mutated as follows. What type of mutation is this? Original DNA: 3'…
A: Biological macromolecules are those large molecules that are necessary for the survival and growth…
Q: Which Strict Operating Requirements DNA Polymerase Has?
A: DNA polymerase is an enzyme involved in the synthesis of nucleotides. These are important for the…
Q: A restriction enzyme digests DNA into fragments. Name the technique used to check the progression of…
A: DNA and RNA are nucleic acids that are found in living cells. Almost all living cells contain both…
Q: Describe the basic structural features of DNA-binding proteins that allow them to recognize specific…
A: DNA binding proteins are proteins that have DNA binding domains and thus have a specific or affinity…
Q: Transposons are useful as mutagens because they act asmolecular tags for genomic DNA sequences that…
A: Step 1 Transposons or jumping gene is a DNA (deoxyribonucleic acid) sequence that can change its…
Q: Using the plasmid map of pBCH2.0 calculate the length of the shortest DNA fragment if this plasmid…
A: DNA- is a deoxyribonucleic acid, made out of two polypeptides. Polypeptides are made from four…
Q: Choose the combination of answers that most accurately completes the statement.Which of the…
A: Restriction endonuclease or restriction enzyme is a type of enzyme used in cloning studies. It is…
Q: The restriction endonuclease NotI recognizes the octanucleotide sequence GCGGCCGC. Calculate the…
A: Restriction endonucleases are enzymes that cut DNA sequences at a specific site known as a…
Q: Which of the following sequences, when combined with itscomplement, would be clipped by a…
A: Restriction endonuclease is also known as restriction enzymes that are produced by the bacteria.…
Q: Human genomic libraries used for DNA sequencing are often made from fragments obtained by cleaving…
A: Genomic Libraries are a set of collections of genomic DNA data particular to a species/organism. The…
Q: Variable number of tandem repeats (VNTRs) in the DNA molecule are highly useful in.......
A: Solution - Variable number of tandem repeats (VNTRs) in the DNA molecule are highly useful in DNA…
Q: A particular variant of the lambda bacteriophage has a DNA double-stranded genome of 51,365 base…
A: DNA is a double stranded helical molecule that is made up of repeating nucleotides. The nucleotides…
Q: Process by which the DNA sequences encoding exons are exchanged and reordered through genetic…
A: Exon :- the coding part of the gene. Intron :- the non coding regions of pre mature mRNa.
Q: Chargaff determined the base composition of DNA from a variety ofdifferent sources. Explain how his…
A: DNA is a genetic element in all the prokaryotic and eukaryotic cells. DNA is double stranded helical…
Q: explain why DNA polymerase 3 and not dna polymerase 1 is responsible for replicating the bacterial…
A: Replication is a process where the genome is duplicated into it's exact copy. In bacteria,…
Q: When linear DNA is sequenced, the nucleotide base pairs are numbered from the start to finish. a DNA…
A: DNA is the genetic material present in all living cells. It carries information from one cell to…
Q: the target DNA
A: CRISPR: It stands for Clustered Regularly Interspaced Short Palindromic Repeats. These are the…
Q: Although RNA polymerase is a processive enzyme that remains attached to the DNA over long stretches…
A: RNA polymerase is an enzyme that assists in the transcription process by copying a DNA sequence into…
Q: The lagging strand is replicated with stretches of Okazaki fragments and its synthesis is considered…
A: Okazaki fragments are short sequences of DNA nucleotides that are synthesized and later linked…
Q: In eukaryotes, RNA primers are primarily removed by a. DNA polymerase I. b. DNA polymerase α. c.…
A: RNA stands for ribonucleic acid and is formed by the process of transcription. Generally, RNAs are…
Q: Show the nucleotide sequence changes that might arise in a dsDNA (coding strand segment GCTA) upon…
A: DNA provides mutagenic bases hypoxanthine and uracil when deaminated by adenine and cytosine…
Q: A DNA fragment with the following base sequence has some cytosine bases that are methylated…
A: The bisulfate sequencing is the treatment of DAN with bisulfite before the routine sequencing for…
Q: Primers are composed of and are made by the enzyme DNA; helicase DNA; primase O RNA; primase O RNA;…
A: A primer is a single strand of DNA that is short and acts as a starting point for the synthesis of a…
Q: Given this sequence: AUG TAT ACC GAG, which of the following would result in a frameshift mutation?…
A: The sudden, inheritable, and stable alteration in the genetic material is said to be a MUTATION. The…
Q: State the characteristics that would be required for using a restriction endonuclease with human…
A: Restriction enzymes or restriction endonuclease are the enzyme naturally present in the bacteria…
Q: The restriction enzymes KpnI and Acc65I recognize and cleave the same 6-bp sequence. However, the…
A: To answer this question we should have knowledge of Biotechnology
Q: An experiment is performed with Primase, using a specific DNA template. In this experiment, you…
A: Radiolabeled nucleotides are used for the detection of specific nucleic acid sequences. For…
Q: A cDNA clone contains (a) introns (b) exons (c) anticodons (d) a and b (e) b and c
A: A gene is the essential physical and functional unit of heredity. They are comprised of DNA…
Q: Some viruses, like SV40, are closed circular DNAS carrying nucleo- somes. If the SV40 virus is…
A: Topoisomerases are enzymes that participates in the overwinding or underwinding of DNA. The winding…
Q: Restriction sites are palindromic; that is, they read the same in the5' to 3' direction on each…
A: Restriction enzymes also called molecular scissors are originally a part of a bacterial defence…
Q: A 10 kb DNA fragment digested with the restriction endonuclease EcoRI yields fragments of 4 kb and 6…
A: Restriction enzymes are also known as restriction endonucleases. These are the enzymes produced by…
Q: DNA polymerases are capable of editing and error correction, meaning it is able to edit and correct…
A: The function of DNA polymerase is DNA replication ,that is, formation of daughter DNA from parent…
Q: Some recombinant DNA techniques depend on the specific hybridization (or annealing) between two…
A: The invention of recombinant DNA technology was carried out by Herbert Boyer & Stanley & N.…
Q: Define about Alu family (the name is based on the presence of DNA sequences recognized by the…
A: Restriction enzymes are DNA cutting enzymes that are found in bacteria and as they cut within the…
Q: A biochemist was able to sequence a DNA found in a human sample from humans who were first believed…
A: The DNA is a self-replicating structure formed of two strands. The DNA is formed of nucleotides. The…
Q: Which of the following are safe havens for transposableelement insertions?a. Intronsb. Exonsc. Other…
A: Transposing elements or the transposons are also known as the jumping genes. A transposable elements…
Q: The restriction endonuclease NotI recognizes the octanucleotide sequence GCGGCCGC. Calculate the…
A: restriction endonuclease is an enzyme that cuts DNA sequences at specific sites.
Q: Define and indicate the significance of (a) Okazaki fragments,(b) DNA ligase, and (c) primer RNA…
A: Introduction DNA replication is very crucial for the continuation of life as every new daughter…
Q: DNA polymerase III in bacteria is responsible for initiating DNA replication by adding nucleotides O…
A: Introduction:- Replication is a process by which a cell duplicates it's genetic material. There are…
Q: Restriction mapping of a linear piece of DNA reveals the following EcoRI restriction sites. EcoRI…
A: Introduction By cleaving the internal covalent bonds between nucleotides, endonucleases breaks down…
Q: What size DNA fragment would be released after very mild digestion of chromatin with micrococcal…
A: Introduction Micrococcal nuclease in as example of endo-exonuclease which is obtained from…
Step by step
Solved in 2 steps
- Search (Option + Q) rences Review View Help Editing v A^ Dv A A A Question 1 During nucleic acid hybridization, the probe is labelled for DNA stability to increase probe-test DNA binding to identify the location of probe and the test DNA binding for amplification Question 2 10 IV 12 13 14 Which of the following best describes the trait in the pedigree? Question 2 options: X-linked dominant X-linked recessive autosomal domiant autosomal recessiveersonal/eenongen_my_tnstate_edu/_layouts/15/doc.aspx?sourcedoc={a6b083c9-a226-4c31... ☆ Search (Option + Q) Review View Help Picture Editing A В ... During nucleic acid hybridization, the probe is labelled Question 1 options: for DNA stability to increase probe-test DNA binding to identify the location of probe and the test DNA binding for amplification Question 2 6. 9. 10 IV 13 14 Which of the following best describes the trait in the pedigree? Question 2 options: X-linked dominant X-linked recessive autosomal domiant autosomal recessive ONPlease answer asap and type your answer and do not copy from anywhere please NOTE*** double stranded complementary DNA I have determined is GTCATACCTAGGGTA with a palindromic site of CCTAGG and the enzyme BamHI that will cut the recognition site. In the double-stranded DNA you have determined, there is also another recognition site for common restriction enzymes. Which enzyme would cut your DNA at this other recognition site? (Hint: Remember that one recognition site can overlap with or be completely contained by the sequence containing another recognition site.) HindIII Sau3AI AluI BamHI
- Hello, I would really appiarte help appreciate help. This is a blank question so I am unsure why it was rejected immeditely the first time. Thank you in advance. Identify the type of mutation and how it would affect the protein made (amino acid) if the following changes occurred in the DNA antisense strand First codon change from TAC to TAT. Third codon change from ACG to ACA. Ninth nucleotide changes from G to T. Nucleotide with adenine (A) base inserted between 3rd and 4th nucleotide. Types of Mutation Changes in the Amino Acid 1. 2. 3. 4.Mutated DNA Sequence #3 T A C A C C T T A G C G A C G A C T … What’s the mRNA sequence? (Circle the change) What will be the amino acid sequence? Will there likely be effects? What type of mutation is this? ________________________________ Mutated DNA Sequence #4 T A C A C C T T G G C G A C T A C T … What’s the mRNA sequence? (Circle the change) What will be the amino acid sequence? Will there likely be effects? What type of mutation is this? ______________________________This test can be saved and resumed later. The timer will continue to run if you leave the test. Completion Your answers are saved automatically. Remaining Trime: 1 hour, 09 minutes, 43 seconds. Question Completion Status: A Moving to another question will save this response. Question 13 True/False Question (suggested time - up to 1 minute): Since there are 20 proteinogenic amino acids, most cells contain at least 20 aminoacyl-tRNA synthetases (one enzyme for each amino acid). O True O False A Moving to another question wili save this response. Iyp
- Original DNA DNA Protein TACGCTATGAGC Methionine-Arginine-Tyrosine-Serine Mutation #1 DNA What type of mutation occurred? substitution insertion duplication deletion TACTCTATGAGCA elearn.squ.edu.om/mod/quiz/attempt.php?attempt-D1335328&cmid%3D6971498&page%=D1 System (Academic) Answer: If a sequence of DNA has 20% Guanine bases how many Adenines would it have? Select one: О а. 10% ОБ.20% O c. 30% O d. 40% O e. 50% A scientist noticed that his sample of cvanobacteria moves towards the side of the petn diKindly help, I don't understand this topic :(( In each of the following DNA sequences, write the contesponding mRNA transcript right beside the item we the item and use the genetic code to determine the resulting amino acid sequence. You may proceed even without the start codon 1. TTTTACCATCCCACAATTTA 2 ACTACTTTCAGAGCTATATTCAG 3. CATTACGGAGCCTGATGCACTTAC 4. TACGCCGCAACTCCGTATGGO 5. Garg-CTACAGCCCTAGCATTTACCCG
- Mutated DNA Sequence #2 T A C G A C C T T G G C G A C G A C T … What’s the mRNA sequence? (Circle the change) What will be the amino acid sequence? Will there likely be effects? What type of mutation is this? ________________________________Please answer fast A. Below is a small 2 exon long gene. The exons are underlined, and the 22 nucleotide long intron is the non-underlined sequence between the exons. TAG, TAA, and TGA are stop codons. 5’-TAGTGTATTGACATGATAGAAGCACTCACTATATTCTGACGTGCGACTATGCGTGGGGTTAGGT ATTGTGCTGACTTTTCTCAGGTGGCCCGTATAGGCTAAGCTGCGCATCGCCGCTAGTCGCTCAGTTCCGC TGGCGGCATTTTAACTTTCTTTAATGAATGCGGGCATATTTAATACGCGCTATGCGCATCGTATGCGAT-3’ 1) What are the first five deoxyribonucleotides of the DNA template strand read by RNA polymerase in the 3’ to 5’ direction? 3'-____ -5' 2) What are the first five ribonucleotides of the mRNA transcript of this gene ? 5'-____-3' 3) What are the first five ribonucleotides following exon 1 in the mature mRNA transcript? 5'-_____-3' 4) What is the 5' UTR of the mature mRNA transcript in ribonucleotides? 5'-_____-3' 5A) What are the first five ribonucleotides of the 3' UTR? 5'-_____-3' B) What are the last five ribonucleotides of the 3' UTR? 5'-______-3' 6) How many amino acids are…Please answer asap and type your answer and do not copy from anywhere please An alien bacteria is found on Mars and is found to contain double stranded DNA. A culture is performed with the bacteria on medium containing radioactive thymine (represented by T*) until all of the thymine in the DNA is radioactive. The culture is then transferred to a medium containing nonradioactive thymine (T). Samples are removed after one round of DNA replication and one portion of double stranded DNA is selected. Two different types of double stranded DNA was identified: Type 1 Type 2 5’ A T*T*T*C G 3’ 5’ A T T T C G 3’ 3’ T*A A A G C 5’ 3’ T A A A G C 5’ What type of replication must be occurring?