Q: GROWTH OF FUSOBACTERIUM ON KANAMYCIN/VANCOMYCIN AGAR (KV) CAN BE DESCRIBED AS a) pigmented b)…
A: Anaerobic gram-negative bacterium called Fusobacterium is frequently responsible for the emergence…
Q: Six months after a stroke a 55 year old woman develops dyssthetic pain involving the entire left…
A: A stroke prevents blood from getting to the brain, which damages brain tissue. 10% of stroke victims…
Q: Why does the endospore retain the green stain, while the ordinary cells do not?
A: It allows the bacterium to produce a dormant and highly resistant cell to preserve the cell's…
Q: Corn undergoes C4 photosynthesis and does not fix nitrogen, whereas Alfalfa is a nitrogen-fixing…
A: C3 plants and C4 plants are the plants which synthesize 3-carbon and 4-carbon compound respectively…
Q: 2. Howler Monkeys - National Geographic: https://www.youtube.com/watch?v=REPoVfN-Ij4 Questions:…
A: Howler monkeys are the largest group among the new world monkeys.These monkeys are famous for loud…
Q: Discuss which attributes you feel are necessary for a successful career in the lab field and why.
A: Attributes are the traits that make us successful. Lab is a place where we do experiments.
Q: just pick an answer choice; thats all I need**
A: 1 : For the first choice based question, the Correct answer is : ( a ) : co- dominant. Explanation:…
Q: Fungi can reproduce through are the result of mitosis of differentiated haploid mycelia. asexual…
A: Introduction Any member of the eukaryotic group of organisms, which also includes yeasts, molds,…
Q: Describe how the diets of specimens I, II, and III differ. Name the special pair of teeth of the…
A: Specimen i : Molar teeth of human Specimen ii : Carnassial teeth of coyote Specimen iii : Herbivore…
Q: An evolutionarily stable strategy (ESS) is a Group of answer choices strategy that, if adopted by…
A: Introduction Evolutionarily stable strategy (ESS):- A behavior that all animals within the…
Q: Ras/MAP kinase signal transduction cascade
A: MAPK signaling pathway: It is also known as the Ras-Raf-MEK-ERK pathway. It is a chain of proteins…
Q: Different human individuals can be identified by comparing simple repeats. Come up with a comparison…
A: Biology terms are fundamental concepts and terms used in biology, which is the study of life and…
Q: Instructions: This is a take-home problem to help you practice recent material, and you are welcome…
A: Introduction:- Transcription is the process of synthesis of RNA molecules ( coding as well as non…
Q: The Great Divide When the Isthmus of Panama closed about 3 million years ago, it created a land…
A: A population is defined as a group of individuals of the same species living and interbreeding…
Q: Which of the following is least likely to result in the formation of a cancerous cell? A Dysfunction…
A: A normal cell is said to be cancerous if it looses its property of contact inhibition. In other…
Q: In a dihybrid test cross, the following results were obtained: A‑B‑, 121; A‑bb, 107; aaB-, 115; and…
A: A dihybrid cross is a type of cross in which two traits are involved . Each trait is illustrated in…
Q: Which of the following statements is TRUE regarding regulation of glycolyis? hexokinase regulates…
A: Glycolysis is the process of breaking down glucose to produce energy. It generates two pyruvate…
Q: Who is the author of the specific epithet, if different from the author of the valid binomial name?…
A: The author of the specific epithet Ixora coccinae L. is Lineus. And this is the accepted name of…
Q: 7)One of the factors that determines how proteins fold is A. most hydrophobic proteins are protected…
A: Introduction Protein folding is the physical process by which a polypeptide folds into its…
Q: If the null hypothesis is correct, predict how the proportion of young cacti with nurse plants will…
A: The hypothesis is a supposition and explanation that is proposed. The hypothesis is made on the…
Q: transcription initiation site GCAGTGACCGGATATAACGAAGAGGAATGCCGTACAAA 5' UCCUUAC 3' Which of the…
A: Coding strand is the that strand of DNA whose sequence is identical to the mRNA sequence while…
Q: Both caffeine (coffee, cola) and theophylline inhibit the enzyme phosphodiesterase that converts…
A: What is cAMP? cAMP is a second messenger in cellular signaling pathways. During cellular…
Q: Define "catch connective tissue". Using specific examples from three of the five major living groups…
A: We all know that connective tissue plays a major role in animal kingdom.It mainly coordinates within…
Q: 2. What happens to the follicle during the first 14 days that you plotted? 3. What happens in the…
A: Introduction : The menstrual cycle is the term used to describe the monthly cycle of these changes…
Q: Suppose you are a production manager of a pharmaceutical company, now you are assigned to formulate…
A: The world's biggest preventable reason for death is tobacco usage, which results in cigarette…
Q: From the perspective of the cell receiving the message, the three stages of cell signaling are O the…
A: Cells can communicate with one another through chemical and mechanical signals. *In multi cellular…
Q: Compare and contrast the different experiments of Redi,Needham,Spallanzani and Pasteur on the origin…
A: Origin of life has many theories with various interpretation. Each and every theory differs from one…
Q: The RNA World theory states that RNA preceded DNA as the primary information-storing molecule, and…
A: The RNA world hypothesis states that the self replicating RNA is the precursor to current DNA world.…
Q: The cell bodies of neurons controlling your feet are actually located in your spine. The cell body…
A: Neurons are the cells of the nervous system. These cells conduct the electrical nerve impulses to…
Q: this did not answer d, e, and f of part (c)
A: The enzymes here given are those enzymes which mainly control the metabolism of glucose and…
Q: GTP is an important high-energy molecule that facilitates the activation of many cellular sig- nal…
A: GTP (guanosine triphosphate) is an important energy-carrying molecule used in a variety of metabolic…
Q: A. When specific antibodies bind to virus particles the virus is "neutralized." What does this mean?…
A: The immune system of the body produces antibodies, which are protective proteins. They bind to…
Q: Construct a model that demonstrates how energy is captured in the light dependent reactions of…
A: The mechanism through which plants convert carbon dioxide, water, and sunshine into oxygen and…
Q: What are the formulating ingredients used in nicotine chewing gum? Please answer at your own easy…
A: Nicotine chewing gum is used for the cessation of smoking habit. It helps to decrease the withdrawal…
Q: Discuss the diversity of gas exchange you have observed in Arthropoda?
A: Arthropoda is largest phylum of the kingdom Animalia which includes insects. Word Arthropoda is…
Q: In horses, black coats and trotting gait are dominant while the recessive alleles are white and…
A: As the back coats and trotting gait are dominant, let us take them as B and T. 1. Since the male is…
Q: Which of the following best supports the theory that mitochondria are the product of an…
A: According to the endosymbiotic theory, the cell organelles such as mitochondria and plastids were…
Q: A student wishes to carry out an investigation to determine the role of the drug CORA against MCF-7…
A: Cancer is a broad term used to describe various diseases in which abnormal cells divide and grow…
Q: Question: To cause overexpression of the genes it controls, would MECP2 protein have to remove…
A: The MECP2 gene codes for the production of a protein known as MeCP2. This protein regulates gene…
Q: 5. A man who is not bald married a non bald female whose mother is bald. A. What is the chance that…
A: Introduction:- Traits are the phenotypic expression of genotypic constituent of an individual.…
Q: For this plant with binomial name Ixora coccinea L., What is the reference to the publication of…
A: Ixora coccinea L. is a popular flowering plant. The binomial nomenclature was put forward by Carl…
Q: THE SPECIATION OF THE TWO MOST COMMON FUSOBACTERIUM PATHOGENS CAN BE ACCOMPLISHED BY WHICH…
A: In microbiology, Fusobacterium can be described as a genus of gram-negative bacteria which thrives…
Q: Quadrat-Based Estimates The simplest description of a plant community in a habitat is a list of the…
A: abundance is the relative representation of a species in a particular ecosystem. It is usually…
Q: Discuss the human impacts on aquatic ecosystems
A: Numerous human activities have an adverse effect on the natural environment, including overcrowding,…
Q: case study : Consider this case: Marlee, a 47-year-old elementary school teacher, goes to her…
A: Introduction Pressure plays a vital role in sustaining the normal physiology of the body. There are…
Q: for 14. Everyone in Squidward's family has light blue skin, which is the dominant trait for body…
A: A Punnett square is an illustration of the potential genotypes of an offspring resulting from a…
Q: Why is a DNA double strand break (DSB) a more detrimental lesion than a mismatched nucleotide or a…
A: A cell's genome is continuously harmed, which is unavoidable since DNA damage frequently results…
Q: Discuss the significance of angiosperms to humans and natural ecosystems. (make it short please)
A: Introduction Angiosperms are flower-producing plants that constitute around 300,0000 species. They…
Q: The lactose operon is likely to be transcribed when _____. A) there is more glucose in the cell than…
A: The initiation of transcription determines the regulation of prokaryotic genes. The regulation of…
Q: #2. Match the following with the correct type of ecology: Use checkmark Population Ecology #2a. Some…
A: We first define these four types of ecologies to understand the final answer. 1. Organismal Ecology.…
Does high temperature increase plant respiration? Why or why not?
Step by step
Solved in 3 steps
- What is/are the differences between photosynthesis and respiration? What is the relationship between respiration and plant growth?Why are plants that consume 30 ATP molecules to produce one molecule of glucose (rather than the usual 18 molecules of ATP per glucose molecule) favored in hot climates but not in cold climates? What role does temperature play?Under what conditions does plant tissue experience lack of oxygen? How is ATP generated from glucose without oxygen?
- how will thermoregulation of plants be affected if transpiration will not occur?How does a green plant obtain energy? carbon? How does your body obtain these things?Is the following statement true or false? Unlike animals, which make many ATP by aerobic respiration, plants make all of their ATP by photosynthesis.
- Animals typically use fats in adipose tissues for longterm energy storage, whereas plants use starch in roots. How do animals benefit from using fat? How do plants benefit from using starch? Name two plants that storeenergy for many years. How long is long-term storage for these species? What two plant parts often use fats and why? Storage tissue in enlarged roots is vascularized. How is that important to the plant?How do plants get the food that is used in cellular respiration?If a plant was deprived of glucose, what would happen? Group of answer choices a-It would make its own glucose and be perfectly healthy. b-It would perform alcoholic fermentation instead of respiration. c-Its chloroplasts would no longer function correctly. d-It would perform lactic acid fermentation instead of respiration. Photosynthesis would stop occurring, causing the leaves to change color.