During the process of anaerobic cellular respiration, the final electron accepter in the electron transport chain is A NADH B. 0₂ C. ATP D H E. H₂O
Q: To determine: The features of a fungus's body structure that is related to its method of acquiring…
A: Organisms that are neither plants nor animals are classified as fungi. Yeasts, moulds, and mushrooms…
Q: A B Blood vessel A supplies two body organs namely the and the
A: The given diagram shows an amphibian circulatory system. The circulatory system is responsible for…
Q: ATCGGCTAGCTACGGCTATTTACGGCATAT The above string of nucleotides represent a DNA leading strand of…
A: DNA is a double helical structure composed of two DNA strands.
Q: Describe the animal Aye-Aye’s heart,Accessory organs,mouth/nose,trachea,and lungs
A: Organ system Organ Human Pig Aye-Aye Digestive Mouth the buccal cavity contains many boiled starch…
Q: Explain advantages of seeds in plants and enlist the process by which the plants that lack seeds…
A: Plants are eukaryotes that are multicellular and mostly photosynthetic. They are members of the…
Q: (Clumped) & (quadrat)
A: Dispersion is the term in ecology involves the movement of an individual or multiple individuals…
Q: Kevin and Sonia want to prepare a bean salad for the class picnic. They buy a package of dried…
A: Introduction: To soak beans the old-fashioned manner, cover them with 2 inches of water, 2 teaspoons…
Q: Answer the following about low carbohydrate diets: true false Is made up of a large about of nonfat…
A: Introduction Carbohydrates form important biomolecules in the diet of every organism. These…
Q: Diagnostic mammography beast in women experiencing symptoms as lump, pain, skin limping or nipple…
A: Mammography Mammography is a process in which a low energy X rays is used to diagnose breast.
Q: Which macromolecule is made from aldehydes and ketones containing numerous hydroxyl groups and are…
A: Answer :- Correct option is A) Carbohydrates Carbohydrates, additionally called sugars, area unit…
Q: Clearly distinguish between the terms diffusion and osmosis.
A: Introduction: Osmosis and diffusion are two types of passive transport that are important for…
Q: 2. A white cat (W) and a brown cat (B) mate and the offspring is an orange cat (WB). white cat brown…
A: Introduction Incomplete dominance is a type of gene interaction in which both alleles of a gene at…
Q: Who is the artist Maria Sibylla Merian and what is her most famous painting.
A: Merian wrote famous books like Blumenbuch (“Book of Flowers”), Neues Blumenbuch (“New Book of…
Q: You cross pure breeding plants with short stamens and white flowers to plants (also purebreeding)…
A: Map distance reflects the physical distance between two genes or two alleles. The genetic map is…
Q: Does this epidemic curve suggest a point source or propagated epidemic? Justify your answer. What…
A: A disease is caused by a deficiency or infectious particles.
Q: choose a product of nanotechnology found at home. Discuss the purpose and how the technology is…
A: Nanotechnology essentially means employing the matter at a tiny scale, at the atomic and molecular…
Q: Why does clumping occur when the Staphylase reagent is mixed with S. aureus cells?
A: Introduction The ability to produce both free and bound coagulase is a widely recognised…
Q: Please explain the cloning steps.
A: Cloning is a series of advanced molecular experimental techniques for assembling recombinant DNA and…
Q: Label the 48 hr chicken emrbyo
A: Embryo It is a product of fertilization that results from the fusion of an egg and a sperm. The…
Q: Answer the questions in the frame below. 1. What organ(structure) is shown in the figure? 2. What is…
A: The development of various organs in the embryonic stage is a time-bound and complex process.…
Q: A transmembrane protein has the following properties: it has two binding sites, one for solute A and…
A: Introduction :- Transmembrane proteins (TP) are integral membrane proteins that traverse the entire…
Q: Explain the pollen grain and its role that it played in helping plants colonize in dry land.
A: A pollen grain is a small structure containing a plant's "male reproductive cell". It is essential…
Q: If the test method used in the laboratory varied from the specification, how will it affect the…
A:
Q: Retina is the part of the eye where the image is formed. What protein sends chemical message to the…
A: The eyes are the photosensitive organ in our body that helps us in visualization. The retina is the…
Q: Omics techniques 100?
A: Omics techniques is a technique which can measure the total composition of a specific biochemical…
Q: Critics of evolution often cite the fact that several hypotheses are being tested to help explain…
A: Introduction Evolution is the process of a species' features changing over numerous generations…
Q: 10 Which of the following would be a case of evolutionary migration (gene flow)? A. Warblers of a…
A:
Q: The non-wild-type alleles are k (clipped wings), l (long tail), and m (magical powers). The parental…
A: Since we only answer up to 3 sub-parts, we’ll answer the first 3. Please resubmit the question and…
Q: 20- 21, 19 18 24 26 225 23 16 15 10 48 hr Chies Transver
A: Chicken embryo can be developed such as the way Egg inoculation technique is done in labs.A…
Q: The Innate and the adaptive Immune Response of coronavirus explain ?
A: Introduction: The mechanism wherein the body tries to defend itself against potentially harmful or…
Q: Cohort: Trematoda Order: Diplostomida Genus: Schistosoma Common Name: Blood Fluke
A: Introduction Blood fluke (Schistosoma) are the parasitic flat worm causes infection in human called…
Q: Label the following. Synovial Cavity Articular cartilage Fibrous capsule Synovial membrane.
A: The freely movable joints or synovial bone joints or diarthroses (singular: diarthroses) are the…
Q: Give an example of a concrete situation, in the human body, which would lead to DNA replication and…
A: DNA replication refers to the production of more copies of DNA using the available DNA as a…
Q: What will you do on an exam or problem set regarding fungal genetics if the longest distance is…
A: Microbiology is the branch of biological sciences which deals with microorganisms. Microorganisms or…
Q: Which of the patterns below is not an MII pattern? A в с D
A: In some fungi, product of meiosis is four spores or eight spores.
Q: Query Sequence A 0 Database Sequence B 10 0 5 Match 1 30 35 38 25 40 30 33 Match 2 Mismatch Match 50
A: Sequence alignment refers to the arrangement of the DNA/RNA/protein sequences to find out the…
Q: The antibiotic erythromycin works by blocking ribosomal movement (translocation) along an mRNA, in…
A: Introduction: One of the most prevalent antibiotic mechanisms of action is translation inhibition,…
Q: To explain: The evolutionary changes in the plant reproduction that are adapted by plants to…
A: The change of a species' defining feature over numerous generations is referred to as evolution,…
Q: Consider a transmembrane protein that forms a hydrophilic pore across the plasma membrane of a…
A: Membranes are composed of a hydrophobic core of phospholipid tails.
Q: Chemical composition of carbohydrates
A: Introduction: Carbohydrates are sugar molecules that are part of a wider group of macromolecules…
Q: 33. 32 31 35 34 30- 36 29- 28 37 38 27 39 26 40 25 41 24 42 23 22 21 20 17 18 19 6 15 16 72hr…
A: Embryology is the branch of biology that studies embryogenesis, or the formation of an embryo out of…
Q: RISA
A: The full form of RISA is Ribosomal RNA Intergenic Spacer Analysis. This type of analysis is referred…
Q: Match the appropriate terms to their definitions TCA cycle or 4 tricarboxylic acid Choose.. cycle…
A: Question: Match the appropriate terms to their definitions Terms : TCA cycle or tricarboxylic acid…
Q: If a cell were damaged, & DNA ligase could no longer be produced, how would replication be affected?
A: Each strand of DNA participates in DNA synthesis due to its double helix structure. DNA synthesis is…
Q: There are various types of DNA-targeting drug, including DNA alkylating agents, DNA intercalators…
A: Mutations are DNA errors that occur during life. A mutation is defined as any alteration in the DNA…
Q: During the Olympic Games the sports commentator is often heard saying “ These athletes are really…
A: Introduction: Respiration is one of the most important processes that all living organisms go…
Q: Cultivation of viruses in prokaryotic hosts and animal cells as hosts.
A: To isolate and identify viruses in clinical samples is the main goal of virus culture. to conduct…
Q: Below are DNA strands. Make the complementary DNA strand: Original Strand: 5’ A T G C A A A T T G C…
A: Deoxyribonucleic acid or DNA is the molecule that carries genetic information for the development…
Q: What clinical symptoms can an inherited deficiency in complement components C3 or C4 lead to?
A: Introduction: There are three primary pathways in the complement cascade, each of which is activated…
Q: Bertha is a 75 years old First Nations elder who is recovering from a fractured pelvis. She has…
A: Introduction The respiratory rate is the rate at which one breathes; it is determined and…
Step by step
Solved in 2 steps
- Which of the following statements about oxidative phosphorylation is correct? O H+ ions are transferred from Complex I or Complex II to ATP synthase where ATP production occ O Proton pumps transfer electrons from the cytosol to the mitochondrial matrix as electrons are tra O The chemical and electrical gradient is established between the intermembrane space and the ma electron carriers. O ATP synthase pumps electrons back to the intermembrane space as a consequence of electrocher mitochondrial matrix. • Previouswithout oxygen US V 11 glucose G 2 13 14 pyruvate with oxygen acetyl Col CO₂ CO₂ Using the diagram above, fill in the chart below for a summary of cellular respiration taking place in the mitochondria. X₂ X² но B I 2 4 electron transport system C > X Q 흐트 E Summary of Cellular Respiration Name of Location Brief Is ATP process of process Description produced? I E D10) a) Explain why the electron transport chain (ETC) is important for the energy producing in the cellular metabolism. b) Describe and explain the route followed by electrons from glucose to 02 and ATP synthesis. (think the energenics and chemiosmotic theory) Cytnsol mtochondrial montane intarmentne Iligh ner mtochordrial membane Matrt Law (1 ADPP ATP
- Referring to the figure below, explain why NADH yields more ATP than FADH2 does. Electron-transport and proton pump Oxidative phosphorylation Outer mitochondrial membrane H* -Intermembrane H+ H+ H+ space H* H+ H+ Cytochrome c H+ COQH, CoQ UU COQH2 CoQ JU U Inner mitochondrial membrane Ht e ATPase Complex II Complex II Complex IV Complex e ADP +P - Mitochondrial matrix NADH NAD+ FADH2 FAD АТР H+ -H+ H+ H20Medical researchers are studying a patient with the newly discovered u LEKS metabolic syndrome, in which a genetic mutaton prevents NADH produced in the cytosol from being reoxidized by the electron transport chain. Suppose the following nutrient molecule is digested and metabolized by this patient under anaerobic conditions, e.g. during a sudden intense exertion: de HO-CH: -OH Он н. HO H OH How many ATP molecules will uttimately be produced by the catabolism of this molecule? Note: you can ussume the catabohism is as complete as it can be under the conditions given above. How many molecules of pyruvate will be produced during dycalysist How many maleoules of lactate will be producedIn the presence of excess oxygen, a complete oxidation of seven molecules of glucose into carbon dioxide and water, by a yeast cell, would produce approximately ATP molecules via oxidative phosphorylation only. (Consider NADH = 3 ATP and FADH2 = 2 ATP)
- If K* and valinomycin are added to respiring cells, fully coupled ATP-synthesizing mitochondria, explain what will happen to the pH gradient and the AY. Compare the action of valinomycin with gramicidin in ATP production and electron transport.Give all the reactions that will produce ATP either by substrate-level phosphorylation (SLP) or by oxidative phosphorylation (OP). If the given require a shuttle system, please indicate both MA shuttle and GP shuttle and give the ATP produced. Given: fructose 6-phosphate to 2pyruvateGive all the reactions that will produce ATP either by substrate-level phosphorylation (SLP) or by oxidative phosphorylation (OP). If the given require a shuttle system, please indicate both MA shuttle and GP shuttle and give the ATP produced. Given: glucose 6-phosphate to 2succinly CoA
- Which of the following is true for both aerobic and anaerobic cellular respiration? A B с D oxidation of FADH₂ to FAD reduction of FAD to FADH₂ oxidation of NADH to NAD + reduction of NAD * to NADHConsider the following diagram when answering the questions about cellular respiration. (a) Label the diagram. (b) Considering the electron transport chain. Why type of cell transport is happening at the ETC? Explain. (c) What type of cell transport is happening at ATP synthase? Explain. B A D ECyanide poisoning inhibits aerobic respiration at cytochrome c oxidase. Which of the following is NOT a result of cyanide poisoning at the cellular level? Select an answer and submit. For keyboard navigation, use the up/down arrow keys to select an answer. a b с d e Oxygen is reduced to water The rate of glycolysis increases Cells are forced to switch to anaerobic respiration The electron transport chain is not completed None of the above Answered K Open in Reading View ✔Posubmit