Q: Choose a disease of the digestive system and discuss the following: - Indicate why you chose the…
A: Answer :- The disease of the digestive system :- Chronic diarrhea. - Diarrhea is a digestive…
Q: The concept that traits in parents are mixed together to form an intermediate condition in their…
A: Answer : Option (2) is correct. - blending inheritance.
Q: 5. Pernicious anemia is a disease in which the intestine is unable to absorb vitamin B12, frequently…
A: As already mentioned in the question pernicious anemia is a disease which occurs due to inability of…
Q: make glucose and the oxygen is released as molecular oxygen. If you do the math how much…
A: In photosynthesis green plants use energy from sunlight to convert atmospheric carbon dioxide and…
Q: What is the origin of the blood vascular system both in embryonic and in the extraembryonic areas?
A: Embryonic development, also known as "embryogenesis", is the process through which an embryo…
Q: in what meitotic phase we can identify bridge abberation? anaphase I or Metapahse I?
A: During cell cycle breaks are induced after DNA synthesis . During chromatid abberation…
Q: Discuss in details, the adaptations that Orobanchaceae (plant) has evolved to invade and manipulate…
A: Introduction Orobanchaceae:- It is a family of mostly parasitic plants of the order Lamiales, It is…
Q: Most have well defined 3' ends terminating in poly(A) tails of - 200 nt. A prokaryotic mRNAs B…
A: The 3' ends of RNA transcripts synthesised by RNA polymerase II are produced bynthe endolytic…
Q: In an experiment to test the activity of lactase under different conditions, tubes containing…
A: Lactase, a sugar found in milk, is a digestive enzyme that catalyzes the breakdown of lactose.…
Q: Question 27 To make RNA the nucleic acid sequences get read in the directi -- Sense → Antisense O…
A: Nitrogen-containing bases, phosphate groups, and sugar molecules make up nucleic acids. Each nucleic…
Q: Metabolic syndrome is a clustering of various conditions including high blood pressure, high blood…
A: Metabolic syndrome is a group of disorders that occur in tandem and increase your risk of heart…
Q: a gene insert itself into a bacterium’s Genome often distracting part of the genome. This is an…
A: Several types of techniques are incorporated in the molecular biology to get more desirable results…
Q: The quail somites transplanted in a conventional order were able to develop normally in the chick…
A: Induction is the process by which the presence of one tissue influences the development of others.…
Q: Which is most important in catalysis of peptidyl transfer? A Massively parallel sequencing data…
A: Peptidyl transferase is used in the process of translation where protein is synthesized. Proteins…
Q: If the first G changes to A what kind of mutation will happen? Show the change in amino acid…
A: When there is an error in the DNA sequence during replication it causes a change in the DNA…
Q: A farmer wants to breed a variety of taller corn. a) How can the farmer use variation in the height…
A: Introduction Selective breeding involves pairing up parents with similar characteristics in order to…
Q: What cell receptor does adrenaline reach
A: Adrenaline or epinephrine is a hormone released by the medulla of the adrenal glands. It is released…
Q: The first step in the formation of urine is formation of filtrate that accumulates in Bowman's…
A: The process of urine formation is done in the nephrons present in the kidneys. The nephrons are…
Q: Match the concept in column A to the concept in column B. Write the letter of the correct answer on…
A: Molecular biology is the study of biological processes at molecular level. It includes various…
Q: Give economic and ecological significance of Corn (Zea)
A: Zea It is commonly known as corn. It is a cereal grain. The plant has a leafy stalk which have…
Q: Which option is a nonrenewable source of energy Petroleum Sunlight Water Wind
A: We used energy from our environment to do verious work. For light, heat, current, industry we used…
Q: In the 33 hr. chick embryo stage what structure/s would serve as a guide to approximately…
A: Auditory vesicles are distinct. Three pairs of arterial arches arise from the ventral aorta. Somites…
Q: With the aid of diagrams, and using specific examples, describe how gene expression is regulated in…
A: Transcription Is the process of formation of mRNA from DNA and this happens in the cytoplasm of the…
Q: Certain cells in the retina respond differently to the direction in which objects move. To…
A: A retinal ganglion cell (RGC) :- is a kind of neuron which is found near the inner surface of the…
Q: Discuss, the adaptations that downy mildew (plant) has evolved to invade and manipulate the hosts…
A: Downy mildew Is a fungal infection. Causative agent : phylum Oomycota Environmental condition…
Q: Select two of the following major meridians that are paired and answer the Five associated…
A: Disclaimer: “Since you have posted a question with multiple sub-parts, we will solve the first three…
Q: 1. The physical factor influencing water entry into and exit from cell interior resulting in…
A: Introduction A pathogenic bacterium, or microbial cell, is a living entity that is too small to see…
Q: Bradley did two test PCR experiments with his phage genomic DNA. For one experiment he used G…
A: For categorizing phages, the term 'clusters' is used for groups of similar phages. It aids in…
Q: septic shock is a life -threateningcondition caused by an overwhelming A inflammatory…
A: C. most suitable answer is.. Failure of blood clotting cascade.
Q: What is biomass
A: Biomass is defined as the total quantity of plants in a particular area.
Q: Distinguish between positive and negative control. Give examples of each from the lac operon
A: Operator is a unit consisting of one or more cistrons that function coordinately under the control…
Q: The ability of oxygen to bind hemoglobin changes with altitude as shown. Which statement, if true,…
A: The binding of oxygen and heamoglobin depends on the partial pressure of oxygen in the body and In…
Q: What are the sensory inputs to skeletal muscles and associated structures
A: Musculo skeletal system is one of the major organ systems of the body.Skeletal muscles are attached…
Q: Answer the following questions about this phylogenetic tree. What animal represents the out group in…
A: According to bartleby guidelines, only the first three subparts have been answered. Kindly post the…
Q: The first step in the formation of urine is formation of filtrate that accumulates in Bowman's…
A: The renal system's primary activities include the management of ECF volume and blood pressure, the…
Q: Describe the features of the fluid mosaic model of the cell membrane.
A: Cell membrane It is defined as the membrane that protects the cell from its environment by…
Q: Choose one 10 6. When you move up an energy pyramid, the amount of available energy by %. Therefore,…
A: The graphical representation of food relationship between the members of different trophic levels of…
Q: Can (1) chain and (2) ring structural abberations still lead to fertile gametes? explain
A: Abberations indicates the genetic material which should be DNA . The DNA transfer the information…
Q: of most hemoglobins when: 1. deoxygenated blood enters the capillaries in the lungs. 2. oxygenated…
A: Answer :: Hemoglobin-oxygen dissociation curve as the name suggests describes the relation…
Q: Describe the three domains of a receptor tyrosine kinase. Explain the structure of the…
A: Receptor Tyrosine kinase are the most effective high affinity cell surface receptors that acts for a…
Q: (Select one answer from each dropdown menu and fill in the blank:) In meiosis, the goal is to get…
A: Meiosis is the reductional cell division where four daughter cells are produces with haploid number…
Q: Enumerate primary organ rudiments that have started to take form in the 24 – hour chick embryo…
A: Introduction A multicellular organism's embryo is the first stage of development. Embryonic…
Q: True or False: 1. There is a reduction in the length of the DNA after every round of replication.…
A: The heterocatalytic process by which a new DNA strand is synthesized on a old DNA template is known…
Q: How do plants and animals regulate their body fluids? Why do you think body regulation is important…
A: Homeostasis is defined as the state of maintaining body balance among all the body systems that is…
Q: What causes allele frequencies to differ between biological populations?
A: Allele frequency Allelic frequency can be defined as relative frequency of an allele at a…
Q: Viruses with reverse transcriptase enzyme can make a DNA copy out of its RNA genome. What…
A: Reverse transcriptase (RT) It is an enzyme through a single-stranded RNA transcribes into the DNA.…
Q: Dihybrid Crosses - Problem 1 I IHINK WE WERE IN THE BATH TOR TO0 LONGI WE'LL STICK WITH PEAS FOR THE…
A: Alleles are the alternative forms of a gene that are located on the same locus of a homologous…
Q: (Select one answer from each dropdown menu:) DNA replication uses as templates to make an Choose…
A: Replication is a process by which two identical copies of DNA are produced. The two new daughter…
Q: Write down the complementary mRNA sequence for each of the following DNA sequence. A:…
A: If template sequence of the DNA is A.. mRNA is .. AUGGAUCGCGUGUACAUCCACCCGUUUCAA
Q: Post-transcriptional modifications in eukaryotic RNAS A. addition of CCA at the 5'end of the TRNA…
A: Post transcriptional modification is a process in eukaryotic cells by which newly synthesis RNA…
Explain the difference between resolution and mag
nification.
Step by step
Solved in 2 steps
- Differentiate between the concepts of magnification, refraction, andresolution and explain how they contribute to the clarity of an image.Explain why an image must be centered in the field of view when using low power before moving to a high power magnification.Explain the difference between a transmission electronmicrograph (TEM) and a scanning electron micrograph (SEM)