Formation and dissolution of clots is primarily regulated by   hemolysis positive feedback negative feedback thrombopoiesis

Q: The creation of the Covid 19 vaccine is said to build the body's immune system or defense mechanism ...

A: Different types of vaccines provide protection in different ways. However, all vaccines leave the bo...

Q: What process takes place in the cells of the tree

A: Tree physiology is similar to that of all other plants: their leaves take CO2 from the atmosphere th...

Q: Discuss the mechanism that leads to aggregation of a protein therapeutic via a conformationally-alte...

A: Misfolded proteins acquire a shape that causes polymerization into aggregates and structured fibrils...

Q: Pancreatic juices, saliva, and bile are used only for mechanical digestion? A. True B. False

A: Mechanical digestion comprises physically breaking down food items into smaller chunks in order for ...

Q: Please discuss pathogenicity and the mechanisms by which microorganisms can attack the human body.

A: Any condition in which the body's normal structure or functioning is damaged or hindered is referred...

Q: What will be the role of dentist in preventing antibacterial resistance?

A:    INTRODUCTION       Infections are not mainly respond to the antibiotics are called as antibiotic ...

Q: Which of the following are outputs of the Calvin cycle? Choose all that apply. ATP water carbon diox...

A: Calvin cycle is a dark reaction.

Q: Explain the mechanism by which cells sample extracellular fluid.

A: Extracellular fluid refers to bodily fluid that is not contained within cells. It can be present in ...

Q: What is the advantages if using Kato-Katz method?

A: Kato-Katz method is a widely adopted method to prepare human stools for examination of the presence ...

Q: ) Does the fossil record indicate that life first appeared in the water or on the land?            ...

A: Fossils are the preserved remains of plants and animals whose bodies were buried in sediments. like ...

Q: Achondroplasia is a hereditary condition caused by a dominant allele in humans (dominant allele A). ...

A: Achondroplasia  Achondroplasia is a form of dwarfism in which ossification does not occur properly. ...

Q: How is UV exposure an example of phenotypic plasticity

A: The ability of a genotype to express different phenotypes depending on its environment is referred t...

Q: 10. A population geneticist collected 400 deer mice from the wild. All have normal ears. She raised ...

A: Answer - The laboratory mouse, also known as a lab mouse, is a tiny rodent from the order Rodentia t...

Q: Is Thomas Hunt Morgan an interdisciplinary thinker?

A: Thomas Hunt Morgan Native -American Specialization -zoologist geneticist Famous experiment -dorsophi...

Q: Describe the smaller and largest living unit of nerve cells

A: "The nervous system" of all animals is made up of unique cells known as neurons, which serve as the ...

Q: While investigating the function of a specific growth factor receptor gene from humans, researchers ...

A: Growth factors work by engaging with certain cell surface receptors to control cellular proliferatio...

Q: What are two main criteria for sustainable process analytics in the bioreactor?

A:   Bioreactor is a type of fermentation vessel that used for protection of many chemicals and biologi...

Q: 1. Discuss how the transcending functions are associated with the integrative levels of organization...

A: Ecosystems are arranged to help researchers better understand the context in which they are being ex...

Q: What is an non pharmaceutical intervention for an flu outbreak in a community? And what questions co...

A: Based on limited data, the World Health Organization's recommended pandemic influenza interventions ...

Q: Why do we need to understand cell physiology in public health?

A: Public health is a science of preventing disease and improving the health qualities of communities v...

Q: How is a knowledge on the origin of the insect alimentary canal assists one in understanding each di...

A: Molting that is the process of producing a new cuticle and the subsequent shedding of the old cuticl...

Q: What is the immediate source of energy for simple diffusion? for facilitated diffusion?

A: The process resulting from random motion of molecules by which there is a net flow of matter from a ...

Q: is there a correlation between one medium supporting growth at a wide set range or organismal growth...

A: A growth medium is designed to grow different types of cells. It is also known as culture medium and...

Q: Identify the stages of follicle development in the following images Primordial follicle Primary fol...

A: primordial follicle: single oocyte surrounded by a single layer of granulosa cells.   Primary folli...

Q: Under which scenario can a hawk successfully invade (or persist among) a population of doves?  Grou...

A: The evolutionarily stable strategy, often known as the Hawk-Dove Game hypothesis, is a famous exampl...

Q: Write a brief discussion about "The path of ethical conduct: Learn to do good

A: Ethics define the set of rules provided by an external source. For example principles in religion or...

Q: Which of the following joins Okazaki fragments by forming the last phosphodiester/ester bond during ...

A: DNA Replication is a process in which two identical copies of DNA are made  from the  parent DNA mol...

Q: Explain the relationship between turgor and osmotic pressure

A: Turgor pressure allows the osmotic entry of water through a semipermeable membrane into a cell. This...

Q: Which type of organism (obligate anaerobe, microaerophile, facultative anaerobe, aerotolerant anaero...

A: Introduction :- Obligate anaerobes are organisms that can only survive in oxygen-depleted situations...

Q: Translate this RNA transcript: 5' - UUUCUUAUGUGUCGCCGUAAUUGAUAUUAC - 3'. O Phe-Leu-Met-Cys-Arg-Arg-I...

A: Note: As per Bartleby Guidelines For Remaining Answers Please Repost The Question. Introduction: Tra...

Q: The transcription of many bacterial genes relies on functional groups called operons, such as the tr...

A: Turning/switching genes on and off is referred to as gene regulation. Cells start to take on special...

Q: What role does understanding the origins of the insect alimentary canal have in comprehending each d...

A:   INTRODUCTION        In insects, their digestive system make their nutrients and other sources of s...

Q: In 1997, approximately __________ percent of women and __________ percent of men in America between ...

A: The marital, as well as the living standards, are quite different in the people of America. In Ameri...

Q: Why is it necessary to use contrasting stains while staining

A: Introduction:- Cell staining is a technique that allows you to see cells and cell components more cl...

Q: A population Bottleneck and the Founder Effect are two special cases in which genetic drift can have...

A: Genetic Drift: - When one trait becomes more prevalent in a population as a result of random chance ...

Q: It a student placed a starch in the beaker liquid and iodine solution inside the dialysi tubing bag,...

A: Iodine solution is a good indicator molecule, especially a starch or glycogen indicator. It is a che...

Q: You are a genetic counselor, and you received the following pedigree to analyze. You must determine ...

A: Generation 3 is.... 1. Dd 2, 3,4,5,6.. is dd Genotype.  

Q: How is physiological insect defensive mechanisms carried out by the insect circulatory system? Does ...

A:

Q: outline the use, description, history, and functionality of a compound light microscope

A: Description of Compound Microscopes:-  A compound microscope is an upright microscope that uses two ...

Q: Do explain shortly.  Question:- Sipunculans vary from other annelids in various ways, one of which...

A: Metamerism is a body type exhibited by members of the phylum Annelida. Metameric segmentation or met...

Q: glutamate when it binds to postsynaptic AMPA receptors

A: glutamate is the main excitatory neurotransmitter in the central nervous system, it primarily intera...

Q: Does the type of diet of the insect affect the structure of organs/parts of the digestive system? Ci...

A: The insect digestive system is a closed one with one long enclosed coiled tube called the alimentary...

Q: Explain the concepts of TDT (Thermal Death Time) and TDP (Therma Death Point), and discuss one examp...

A: The thermal death point (TDP) of a microorganism is the lowest temperature at which all microbes are...

Q: Perichondrium is

A: Perichondrium is layer of connective tissue that surrounds the cartilage of developing bone.  It con...

Q: What are the qualities of an appropriate sequence in DNA chromatogram? Why?

A:  Introduction: DNA stands for deoxyribonucleic acid. It's made up of nucleotides, which are biologic...

Q: List out Bone loading bearing's material properties (in bullet point) Explain each!

A: Bone loading : The tibias found in the lower leg below the knees are weight bearing bones . It is on...

Q: How might culture age affect the results of a spore stain? O If the bacterial culture is too young, ...

A: Bacteria are single-celled, tiny creatures that may enter healthy tissues and grow rapidly. The bact...

Q: explain  the scope of practice for EMTs in arizona.  Is the scope of practice dictated by the state ...

A: Scope of Emergency medical technician is good in Arizona.  Avg salary per hour for emt in arizone is...

Q: Explain the level of greenhouse gases in the atmosphere and its impacts in environments with a neat ...

A: Green house effect It is the phenomena where earth surface get heated. It is a natural process. when...

Q: Nde I EcoR I Sal I KpnI BamH I PUST MCS ori Xho I Amp BamH I Kpn I EcoR I BamH gene W pn BamH I Xho ...

A: Gene insertion is that the addition of one or a lot of genes into a desoxyribonucleic acid sequence,...

Hematology

Hematology is the branch of biology. Hematology is the medical field that deals with the treatment of blood disorders and cancers, such as hemophilia, leukemia, lymphoma, and sickle-cell anemia. Hematologists and hematopathologists are medical professionals who specialize in illnesses of the blood and its components.