From the above sequence I have copied the first 500bp of the sequence into Word. ATGGTAAAGGCCGTCGTCGGATTCGGCGCTGCATGCGGAATCT CTGCTATCGTTGCTTGCCTTTGGGCTGCACTTGTCATCACAAA TGACATCAATGACATGTATGATGATGTGATGGGAGAGCTCGGA GGATTCAGAGATATCTCTGATGACACTTGGGGAACCCTTCTCG ACGTTCGTCACGGAGCCGGAGAGTCTGCTGAGCAATACGTTCG TGGAATCTTCGGACGTCACAAGCGTTCCAACAGCCAATGCTCT TGCGGACTTCCATCTCAAGGATGCCCAGCCGGAGCTCCAGGAA ACCCAGGAGCCCCAGGAGAGCCAGGAGGCACTGGACCAGACGG AAAGAACGGACCAACTGGACTTCCAGGACTTAACATTCCAATT CCAAATGACTTCCCTAAGGAGTGCATCAAGTGCCCAGCTGGAC CACCAGGACAAGATGGACTTCCAGGACAAGAAGGATTCCAAGG ACTTCCAGGAGACGCTGGAAAGCGTGG 1) You now need to design primers to amplify this 500bp region of the DNA. Write out the primer sequences in the correct orientation. 2) Decide on two restriction sites that you can use to clone this into pL4440's MCS. Identify their sequence. Tip: The plasmid map is in Figure 3, details of restriction site sequences can be found https://enzymefinder.neb.com/#!#nebheader 3) Add the restriction site DNA sequences to the correct end of each primer. T7 promoter TAGATA Apel GGAATTOGATATOA Foo ATT T7 promoter at 4) List the steps required to clone the PCR prduct into the pL4440 plasmid. Exact recipes and details of PCR mixes + machine conditions etc are not required, just try and think about the whole procedure from start to finish. Figure 3: plasmid L4440 with details of it's multiple cloning site (MCS). You will need to clone, using restriction sites, your DNA sequence into the MCS region of the plasmid. This diagram shows you the restriction sites you can use.