From the options below, select the most likely effect of a mutation that causes cyclin B to be unable to bind CDK a) Cells pass through the G2/M checkpoint and enter mitosis even when DNA has not been replicated b) Cells never pass through the G1/S checkpoint c) Cells pass through mitosis more quickly than unmutated cells d) Cells fail to pass the G2/M checkpoint and do not enter into mitosis Cells do not pass the GO phase of the cell cycle e)
Q: hat is the reason why is it best to examine a freshly collected stool sample in clinical parasitolog...
A: Prokaryotes are unicellular organisms that coinhabit the ecosystem with the eukaryotes. The Eukaryot...
Q: 10. A population geneticist collected 400 deer mice from the wild. All have normal ears. She raised ...
A: Answer - The laboratory mouse, also known as a lab mouse, is a tiny rodent from the order Rodentia t...
Q: What causes platelets to adhere to the wall of a broken vessel? exposure of collagen fibers histam...
A: Hemostasis is the process through which the body prevents wounded blood vessels from bleeding. Too l...
Q: In individuals affected by cystic fibrosis, salt crystals may appear after perspiration dries up. In...
A: Cystic fibrosis It is an autosomal recessive disorder that affects mucus-producing cells. This disor...
Q: What do you mean by “colony” of microorganisms?
A: The earth ecosystem is full of various organisms. These organisms are prokaryotes or eukaryotes. The...
Q: The father of three sons and two daughters begins to show symptoms of Huntington disease. What is th...
A: Huntington's disease has an autosomal dominant inheritance pattern which means a single defective g...
Q: What could be a probable fate of the segment of the DNA strand encircled in red? Polypeptides can n...
A: Option 4 is correct -If the encircled region will not be relaxed by another enzyme, it will experien...
Q: An individual whose genotype is AABbCc is crossed with an individual who is heterozygous for all thr...
A: Gamete being an organism's reproductive cell, is a haploid cell which contains only one set of diss...
Q: In a short personal essay, what is the ultimate purpose of human life
A:
Q: Please match the Arthropod subphylum or class to the description. two pairs of antennae [ Choose ] [...
A: Arthropoda is a largest phylum in Animal kingdom.
Q: Kutritional módes for each of the following organisms: (1) solely photoautotroph, (2) solely chemoau...
A: The basic mode of nutrition can be divided into autotrophic (green plants) and heterotrophic nutriti...
Q: distinguish domain Eukarya from the 2 prokaryotic domains (Bacteria and Archea). Describe and compar...
A: * the three domain system proposed by Carl worse. * It includes bacteria,archae and eukaryota.
Q: How are deoxyribonucleoside triphosphates (precursors of daughter DNA strands) and ribonucleoside tr...
A: The nucleic acids are made up of pentose sugar, nitrogenous base and phosphate molecule. The group o...
Q: Which of the following is the correct passage of the food and water in paramecium? O oral groove-->c...
A: Paramecium is a unicellular, eukaryote protozoan, which lives in the fresh water. It is a slipper sh...
Q: Based on David Attenborough's "Rise of Animals", do new anatomical structures arise de novo? Why or ...
A: The rise of animals by David Attenborough explains that anatomical structures evolve de novo. They n...
Q: Please help me answer this. Discuss the potential of marine organisms as a source of biomolecules/b...
A: Marine organisms have a high potential for the following fields:- Marine organisms have a potential...
Q: Give short description to explain how motor coordination and balance are regulated.
A: A nervous system is defined as an organized group of cells called neurons that are specialized for t...
Q: In cyclic photophosphorylation, an electron in P700 is excited by a photon and begins to taking the ...
A: The light reaction of photosynthesis involves production of ATP and NADPH by using sunlight. In this...
Q: Please choose all the correct statements regarding early chordates. Amphioxus has all four defining ...
A: Amphioxus has all four defining chordate characteristics as an adult- This statement is Correct beca...
Q: Cleavage blastomeres are totipotent. Differentiate th
A: Totipotent : A totipotent cell is a single cell that can give rise to a new organism , given materna...
Q: Roberto and Maria are getting married. They want to know the main events of reproduction in order? O...
A: Organogenesis is a process that follows neurulation and gastrulation. It is where all the three ger...
Q: vector pUST, gene W, and the restriction cut sites. What are 3 cutting strategies for cloning gene W...
A: *Cloning means producing an organisms with identical DNA either by natural or through artificially ....
Q: What is done when there is a delay of stool examination?
A: Q. What is done when there is a delay of stool examination? Answer - When there is a delay of stoo...
Q: During a flame test, why is it necessary to use a new splint for each element?
A: A splint is a thin wood/stick used commonly in laboratory for performing a flame test. The splint is...
Q: The koi (domesticated carp) in this example are one of 3 colors (solid orange, mottled white and ora...
A: Introduction :- Domesticated carps have recently been created in the majority of carp producing regi...
Q: 1. identify and describe the basic structures forming the digestive, respiratory and circulatory sys...
A: Homeostasis is the state of equilibrium inside a system that allows it to function under a range of ...
Q: Translate this RNA transcript: 5' - UUUCUUAUGUGUCGCCGUAAUUGAUAUUAC - 3'. O Phe-Leu-Met-Cys-Arg-Arg-I...
A: Note: As per Bartleby Guidelines For Remaining Answers Please Repost The Question. Introduction: Tra...
Q: Does the ATP synthase protein complex have to be located precisely on the membrane in relation to wh...
A: Plants and many other photosynthetic microorganisms use sunlight to generate food and energy. This ...
Q: Animal Kingdom Do not possess a backbone Possess a backbone Asymmetric, Bilateral symmetry, Four lim...
A: *Invertebrates are the animals do not posses backbone. *Vertebrates are the animals that posses back...
Q: Give a biologic example of the negative feedback loop?
A: Introduction :- A self-regulating system is a negative feedback loop, also known as an inhibitory lo...
Q: 8. In which of these clades (Deuterostomia, Lophotrochozoa, Ecdysozoa, Porifera, and Cnidaria) would...
A: Your answer has strating in step 2. Step 2 image is made by me, in MS word. This image not copied fr...
Q: Suppose a person with the dominate blood form and a person with the other dominate blood form type g...
A:
Q: Explain the main regulator being evaluated in the article histone h4 dosage modulates DNA damage res...
A: In hospitals around the world, that is well stated that they are been defined as the Candida glabrat...
Q: 2. Examine this pedigree chart. mode of inheritance is shown? Explain how you arrived at this decisi...
A: The pedigree chart shown here is a popular tool used in Genetics to explain the mode of inheritance ...
Q: What is the role of ppp1r2 in inhibiting PP1?
A: Protein phosphatase 1 (PP1) belongs to the protein serine/threonine phosphatases family of phosphata...
Q: If the MRNA sequence is 5' - START(AUG) - UUU - AAA - AGU - GGU - 3', then what is the corresponding...
A: Transcribing tRNA from mRNA, mRNA tRNA U A G C A U C C The above table can be used for...
Q: Is reflex the same as reaction time? Explain your answer.
A: Introduction: Reflex action is an involuntary response to stimuli that occurs suddenly. It helps org...
Q: micrograph
A: The ovary is an organ found in the female reproductive system that produces an ovum . Fertilization...
Q: Which of these statements best demonstrates the difference between the action of B cells and T cells...
A: B cells secrete antibodies that contribute to tissue injury via multiple mechanisms. In addition, B ...
Q: explain the scope of practice for EMTs in arizona. Is the scope of practice dictated by the state ...
A: Scope of Emergency medical technician is good in Arizona. Avg salary per hour for emt in arizone is...
Q: Please help me answer this reviewer. Determine what the statement is describing. Fill in the blanks...
A: 1. Non-lethal storage of biological material at ultra-low temperature that almost all metabolic acti...
Q: QUESTION 4 Which of the following is NOTa part of an inflammatory response? O Edema Histamine releas...
A: Inflammation: it is a natural immune response of the body against harmful agents. Inflammatory respo...
Q: how to increase seed and seedling vigour?
A: Seed is the fertilized and metamorphosed ovule containing an embryo enclosed in resistant protective...
Q: Isovolumetric contraction" is a phase in the cardiac cycle in which the volume of a particular heart...
A: Isovolumetric contraction" is a phase in the cardiac cycle in which the volume of a particular heart...
Q: River otter Largemouth bass 10 10 20 30 40 Amblent (environmental) temperature ("C) Based on your un...
A: Any self-regulating process through which an animal maintains equilibrium while responding to condit...
Q: In a three-point testcross the nonrecombinant progeny are A+B+ C+ and a b c. The double crossover pr...
A: Three point cross refers to usinh three genes to determine order and distance between genes. During ...
Q: They have purified a 1100 bp HindIII restriction fragment that they plan to sequence. As a first ste...
A: EcoR1: EcoR1 is a restriction endonuclease enzyme found in the E. coli bacteria. It's a restriction...
Q: Which of the following are mechanisms which prevent clotting under normal circumstances? Select all ...
A: Blood clotting is a complex phenomena which usually occurs when due to any reason blood vessels are ...
Q: 3. Describe three systems that are negatively influenced by chronic stress and the mechanisms and th...
A: Introduction: Stress:•A long-term feeling of being pressurised and overloaded, with symptoms such as...
Q: Which of the following is the ultimate energy source for the organisms (particularly the tubeworms) ...
A: The symbiotic interaction between germs and tube worms benefits both creatures since the bacteria is...
Please answer fast
Trending now
This is a popular solution!
Step by step
Solved in 2 steps
- 1- In the cell cycle the mitosis and meiosis are occurring during. done during. Prior to... G1/cytokinesis/G1 a) b) S/G1/GO c) G2/GO/ S d) None of the above/ GO/ G1 and cell repair is3) Examine the graph showing the relative percentage normal and cancer cells spend in various stages of the cell cycle. Based on the information in the graphs, infer how cancer cells differ from typical, noncancerous cells. Select ALL that apply. A) Cancer cells do not replicate their DNA. B) Cancer cells replicate their DNA too quickly. C) Cancer cells do not go through interphase during their cell cycle. D) Cancer cells spend more time dividing compared to typical cells. E) Cancer cells do not always grow to the same size as typical cells. more than 1 answer. not graded4) Describe in detail how p53 and MDM2 regulate cell division in a normal, healthy cell. You should describe 1) how these proteins cooperate to allow a cell to go through the cell cycle, 2) how they cooperate to stop the cell cycle, and 3) how they allow the cell cycle to continue again after having stopped it initially. You may use point form if you want.
- 3) The tumor suppressor protein Rb regulation of the entry into the S phase of the cell cycle is represented in this diagram. DNA Answer: b) Explain your choice above: Answer: Rb E2F Genes needed for S phase are NOT transcribed Growth factor Ras pathway Cdk-cyclin 30 ATP ADP Phosphorylated Rb protein P Rb E2F Gene transcription a) In hereditary retinoblastoma tumors, Rb is mutated. Among the following mutations, which one is not likely to be found in these tumors. 1) Mutation prevents Rb to bind E2F by modifying the binding site. 2) Mutation prevents Rb to be dephosphorylated and recycled (possibly by prevented phosphorylated Rb to be recognized by the phosphatase that removes its phosphates). 3) Mutation may cause Rb to be misfolded and not have a functional conformation 4) Mutation that prevent Rb to be phosphorylated by cdk-cyclin. 5) Mutation may cause Rb to be unstable and degraded rapidly. c) (4 pts) Human papilloma virus (HPV) infections are the main causes of cervical cancers.…6) What phase of the cell cycle would be altered, and what would change if you treated a cancer cell with a drug that a) interfered with DNA replication. b) stopped the spindle fibers from elongating.Which of the following statements is true about cell cycle checkpoints? Question 5 options: A) G1 checkpoint check for cell size, nutrients, and growth factors availability. B) G2 checkpoint check for cell size, nutrients, growth factors, & DNA damage. C) G2 checkpoint check for chromosome attachment to spindle at metaphase D) All the above are true.
- Cyclin B and Cdk1 make up MPF which is important to the regulation and initiation of mitosis. : a) True b) FalseConsider the figure below showing how the concentration of four cyclins (comp A to comp D) vary throughout the cell cycle. Comp B Comp C Comp D Comp A G1 Phase S Phase G2 Phase Mitosis i) Why does the concentration of different cyclins vary throughout the cell cycle? ií) which of the four cyclins shown represents the G1 cyclin? What is the function of this cyclin? ConcentrationWhich of the following is true with respect to cyclins and CDKs? A) CDKs promote progression of the cell cycle, cyclins function to inhibit progression of the cell cycle B) CDKs are the checkpoints in the cell cycle, and when bound to cyclins, they stop progression of the cell cycle C) CDKs will only work to promote progression of the cell cycle when complexed with their designated cyclins D) CDKs are rarely expressed during a cell's cycle, unless cyclins are present to act as transcription factors .
- Kinetochores control the transition from metaphase to anaphase. Why is this statement true? Question 7 options: a) Anaphase will only begin after the M checkpoint where all the kinetochores and mitotic spindle have correctly attached. b) Anaphase will only begin after the M checkpoint where all the mitotic spindle have correctly formed. c) Kinetochores bind to microtubules in monotelic attachment to the sister chromatids. d) Kinetochores bind to microtubules in syntelic attachment to the sister chromatids. e) Kinetochores will halt at the M checkpoint to weaken the mitotic spindle formation, which is the event that initiates anaphase.Which of the following statements about cell cycle regulators is incorrect? a. The concentrations of cyclins change throughout the cell cycle. b. Cyclins are present in all stages of the cell cycle except S. c. Cyclin-Cdk complexes phosphorylate target proteins. d. Cdks combine with cyclin to move the cycle into mitosis. e. During anaphase of mitosis, cyclin is degraded, allowing mitosis to end.What is necessary for a cell to pass the G2 checkpoint? a. cell has reached a sufficient size b. an adequate stockpile of nucleotides c. accurate and complete DNA replication d. proper attachment of mitotic spindle fibers to kinetochores