Q: Peripheral proteins are proteins in the lipid layer facing inside the membrane True False
A: Cell membrane also called as plasma membrane are generally made up of by phospholipid bilayer in…
Q: Which of the following lipoproteins is primarily involved in the transport of cholesterol from the…
A: Lipoproteins are complicated molecules that have a central core holding cholesterol esters and…
Q: Which of the following statements regarding Darwin and his theory of evolution is false? Darwin…
A: Evolution is the process of change in all forms of life over generations, and evolutionary biology…
Q: auditory nerve
A: Auditory nerves and the brain Nerve impulses are transmitted from the ear to the brain via the…
Q: How do abiotic factors affect species distribution?
A: Biotic factors: Living components of ecosystem. These basically falls under 3 catagories:…
Q: What are the protein/enzyme requirements during initiation, elongation, termination of DNA…
A: In this question we have to describe about Central dogma. See full answer in step 2
Q: Use a simple diagram to explain how presynaptic inhibition works.
A: Presynaptic inhibition refers to mechanisms that suppress release of neurotransmitters from axon…
Q: Decreased prod A) Estradiol B) Inhibin OC) Progesteron D) Prolactin OE) Prostate-spe
A: FSH or Follicle stimulating hormone maintains the correct level of testosterone hormone. When the…
Q: produces
A: 1) false statement , gymnosperms don't produce diploid spores . Sporophyte in the life cycle of…
Q: (i) C. (ii) D. (a) Name the type of blood vessel labelled 4 D- 5 ES 6 Lungs Heart Body organs B
A: In any organism, the heart's job is to keep "blood" flowing constantly throughout the body. Blood…
Q: How many generations are in this pedigree? What sex is the youngest child in
A: Each member in a Pedigree represent whether he is affected or not according to the inheritance…
Q: Which of the following is not a characteristic of plant hormones? They are active in small…
A: Plant hormones (phytohormones) are chemical molecules produced in extremely low concentrations by…
Q: Question 8 Enzymes that move certain phospholipids between leaflets have also which of the following…
A: Enzyme that move certain phospholipids between leaflets have also the property The membrane lipid…
Q: What does the word "patch" denote in a patch-clamp setup? Shape of a glass micropipette Open tip of…
A: Patch clamp technology is a method used in electrophysiology to measure the ionic current. This…
Q: Ο Ο Ο Ο ο ο ο ο ο ο ο ο ο ο Ο ο ο ο ο ο Ο Ο production Primary Sea food and wild rice Spiritual…
A: A bubble of life formed by the the organisms, the environment, the landscape and the weather…
Q: Biology 1. Which statement(s) is/are most correct concerning the history of epidemiology: a. The…
A: Epidemiology The study and analysis of the occurrence, trends, and causes of health and disease…
Q: Two unlinked genes control flower color in snapdragons. You cross a true-breeding yellow flowered…
A: This is a case of recessive epistasis. The rr genotype for R gene is showing epistasis to the W…
Q: Answer for 1 ,2,and 3 asap
A: Answer given in steps 2 onwards. Please find the attachment. Thank you
Q: One way that a cell can turn off or prevent gene expression
A: Each cell expresses, or turns on, only a fraction of its genes at any given time. The rest of the…
Q: Located below is a list of examples of hypotheses. You must critique each hypothesis and assess if…
A: A hypothesis is an assumption that is proposed for so that it can be tested to see if it might be…
Q: Explain how the following conditions will affect the regulation of the operon. Low cAMP levels; E.…
A: Operon is a sequence of DNA that consists of a set of genes which are involved in a particular…
Q: What is RNA polymerase doing on the lac operon in the presence of lactose? it is inactive and not…
A: Operon is a unit consisting of one or more cistrons that function coordinately under the control of…
Q: 39. A 24-year-old primigravid woman at 37 weeks' gestation is admitted because of ruptured membranes…
A: Answer.. Ultrasonography to assess amniotic fluid volume.
Q: Describe how mRNA is created in transcription step by step.
A: Gene expression is a cycle by which the qualities are gone on to frame RNA and proteins. This is…
Q: Give the functions of the following: midrib, veins and veinlets.
A: The midrib is the vein that run through the middle of the lamina. The midrib divides the lamina's…
Q: If there is a defect in the anterior pituitary gland, what should the levels on the below be? *high…
A: Cortisol Releasing Hormone is released from the hypothalamus. CRH stimulates the anterior pituitary…
Q: What determines the maximum rate of Action Potential firing?
A: The action potential is created when the membrane potential in a neuron accidentally rises and…
Q: DNA replication involves a
A: DNA Replication: DNA is a self replicating material which carries the genetic information of the…
Q: highlight the statement at the bottom
A: The circulatory system is formed by the heart, the lungs and the blood vessels. The lungs oxygenate…
Q: (a) Name the type of blood vessel labelled (i) C. (ii) D. (b) In which direction does blood in…
A: Lungs are essential parts of the respiratory system. A pair of lungs in humans are formed in such a…
Q: Question 28 Which characteristic is most likely shared by a cell membrane and a lipoprotein…
A: Lipoprotein particles It is a biochemical assembly that contains both Proteins and lipids, bound to…
Q: Question 7. How might one test whether the differences in moth density in the two types of plants…
A: Answer :- When sent consistently in the field, hereditarily controlled plant obstruction is…
Q: Which describes an enzymatic activity/biochemical function of importin-beta? facilitate release of…
A: Introduction : Importin beta are known as a type of karyopherin proteins which mediates the…
Q: please answer question b also. b. For the Covid-19 pandemic), give any issues, benefits, or…
A: Within the twentieth century, the world suffered pandemics. The pandemics, as horrifying and lethal…
Q: Given this DNA strand: 3’ TACAGTCTGTAGCGTACATTATCGTGACCGACT 5’ Identify the following: mRNA:…
A: The process by which DNA is copied to RNA is called transcription, and that by which RNA is used to…
Q: A heterozygous individual is crossed with a homozygous recessive individual. a. Draw a Punnett…
A: Punnett square of cross between heterozygous individual and homozygous recessive individual.
Q: Question 1 Which of the following lipoproteins is primarily involved in reverse cholesterol…
A: Introduction Reverse cholesterol transport is define as a type of mechanism by which excess of…
Q: 1. What happens to synaptic transmission during an experiment if the preparation (containing 1…
A: Introduction Neurotransmitters are chemical messengers or signaling molecules released from neurons…
Q: During the ion channel transport, some "gates" open and close. This is in response to which of the…
A: Ion channel transport allows the transportation across the cell membrane for selective sized…
Q: i) Describe and explain i) the role that flight plays in creating these kinds of viruses, ii) how…
A: Bats are classified into mammals with the order Chiroptera. Bats forelimbs are adapted as a wings…
Q: Question 9 Why are integral membrane proteins difficult to study? O They are difficult to isolate in…
A: Integral membrane proteins Proteins which are permanently bound to the lipid bilayer. They require…
Q: Which is part of a group of predatory insects? A. Isoptera B. Odonata C. Orthoptera D. Blattaria
A: Insects are pancrustacean hexapod invertebrates of the class Insecta. They are the largest group…
Q: 1) Explain why the process of DNA replication is slower on the lagging strand than on the leading…
A: DNA replication is a process in which from one Duplex DNA ,two identical copies of DNA is…
Q: When would a population grow in an exponential manner? If limiting factors are not present If it…
A: Populations with unlimited natural resources grow very rapidly, after which population growth…
Q: What will be the complete hydrolysis products of the given structure below? CH₂-0-C-C17H37…
A: Given structure is a phosphatidylcholine (PC) It belongs to the class of phospholipids that has…
Q: Larvae and pupae per Bt plant 100 Ö TOKH company -- Mosaic, Cry1Ac plant --- Mosaic, Cry1C plant --…
A: Mosaic treatment of plants and density of moths after treatment.
Q: What does the word "patch" denote in a patch-clamp setup? Shape of a glass micropipette Open tip of…
A: The patch clamp technique is a laboratory technique in electrophysiology used to study ionic…
Q: 1) The nitrogenous bases content of a sample of DNA was found to be 3.2% adenine. Determine the…
A: A nucleic acid is a linear polymer of nucleotides that is a component of the cell's information…
Q: efer to the table below: Saponification Number 179 260 193 185 lodine Number 102 10 111 79 Oil…
A: Introduction Iodine number defined as the number of grams of iodine that are consumed by 100 gram…
Q: Which of the following is not an example of a protein with a quaternary structure? Haemoglobin in…
A: Proteins are the polymer of amino acids. These amino acids are joined by peptide bonds.
Step by step
Solved in 3 steps with 1 images
- Give some characteristics of histocytes.Define Cellularresponsesto adhesionreceptorsignalingStep1:Clickwhereitsays“StartaNewGame.”Inordertomakenewbodycells,thecellcycle mustoccur.Duringthecellcycle,onecelldividestoformtwodaughtercellswithexactlythe same___________.Thecellcycleincludesthefollowing:________________________________, _________________________,and_________________________.Interphasehappens__________ ______________.DuringInterphase,thecelldoesnormalactivities,likemakingproteins,for example.