Hair: DNA: CCGGTGTACACAGGGACCATTCGATTA MRNA: protein: phenotype:

Q: What can happen when cell division goes wrong? Not able to sleep Explosions Hunger Cancer

A: In eukaryotes, two types of cell division divide the genetic material into daughter cells. One…

Q: hich of the following processes DOES NOT involve EMT? Cancer metastasis. B) Formation of the neural…

A: Epithelial mesenchymal transition is an important process where, polarized epithelial cells undergo…

Q: DNA leads to RNA which can leadto the creation ofa. proteins.b. lipids.c. cells.d. oxygen.

A: Replication is the process when DNA replicates itself means it will make copies of itself with the…

Q: In membranes, , motion is fast and motion very slow. a. down, up Ob. transverse, lateral C. lateral,…

A: Membrane : It is a selective barrier; it allows some things to pass through but stops others. Such…

Q: The differences in human skin color are caused by: the amount of melanin in the skin. the amount of…

A: Given: The amount of carotene or distribution of melanine. Carotene are the Photosynthetic pigments…

Q: cancer can build up within an organism and creates a mass called a what

A: Given: Cancer can build up within an organism and creates a mass.

Q: body cells from sex cells.

A: Cells are the unit of life. Cells play various functions in the body. The cells comprise to form…

Q: Which one of these cell types lacks a cell nucleus and therefore have no DNA? A) Glia cells B) Red…

A: Introduction : The nucleus is a sphere-shaped organelle found in eukaryotic cells. It contains the…

Q: What are cells that have been made ready for transformation by exposure to chemicals called? O…

A: Bacteria is the unicellular organisms they are different types of bacteria many lives in different…

Q: Stem cells can give rise to many different types of cells. How could stem cells most likely be used…

A: As stem cells are the cells which have the ability to divide and can give rise to many different…

Q: Somatic stem cells are found in...   all choices are correct       embryonic tissues       adult…

A: somatic stem cell are found in adult ,sometime somatic stem cell also called adult stem cell .Where…

Q: Stem cells: What property of stem cells makes them interesting to scientists?

A: Stems are unspecialized cells that do not have any physiological properties. It is self-renewal that…

Q: DNA Replication takes place during and the end result is

A: The suitable answer to your problem will be: DNA replication takes place during S-phase of…

Q: __________________ glands produce body secretions onto internal/external surfaces. The fluid matrix…

A: Since you have posted multiple questions we solve the first three questions for you. To get the…

Q: The nucleotide sequence in DNA encodes the primary structure of a protein. If there was a mutation…

A: A nucleotide is defined as an organic molecule made up of a nucleoside and a phosphate, and thus, it…

Q: all organims use ____ to fuel growth and to sustain homeostasis, which is a process that maintains…

A: There are innumerable activities and reactions going inside the body to maintain the state of…

Q: explain to a 5th grader why late stage cancer if so dangerous for your body.

A: Question asked: Explain to a 5th grader why late stage cancer if so dangerous for your body.…

Q: Q6

A: A mutation is a change in the structure of a gene, which is the fundamental unit of inheritance.…

Q: The genotype is the amount of each protein that is contained within a cell. the observable…

A: Genetics is a branch of science that deals in the study of genes, heredity, and genetic variation of…

Q: Genes code for which of these biological molecules? O Proteins Lipids Membranes Organelles

A: Gene are the basic unit of hereditary.

Q: back and fill in the missing term. Highlight the terms. Terms to use: muscle, blood, skin, red…

A: Body is composed of various cells, tissues, organs and organ system. The cells are the basic unit of…

Q: The information regarding cell functioning is carried out of the nucleus by   a. amino acids.   b.…

A: DNA is genetic material present inside the nucleus . Nucleus control many activities of the cell .…

Q: TRUE or FALSE: Cancer is not a single disease, but includes many different diseases. TRUE or FALSE:…

A: 1. Cancer is a genetic disease in which abnormal cells divide uncontrollably and destroy body…

Q: Cells from skin Blood cells Cells from lining of bladder Cells from lining of trachea These groups…

A: Introduction:-  Body is made up of smallest unit called cell. Cell is the basic unit if life.Cells…

Q: A scientist performs an experiment in which she finds a number of anticodons in a cell's cytoplasm.…

A: Replication is the synthesis of DNA and transcription is the synthesis of m RNA from DNA and…

Q: ?Which Of The Following Is True About The Nucleus It Is Responsible For Protein Synthesis It Is…

A: The cells contain different organelles like lysosomes, mitochondria, Golgi apparatus, nucleus,…

Q: Which statement best describes the manner in which the genetic information is used inside cells?…

A: Cells are the basic structural, functional, and biological units of all living organisms. It is the…

Q: Discuss the importance of Stem Cells.

A: Since you have asked multiple questions, we will solve the first question for you. If you want any…

Q: Your body is made up of over 200 different cell types These cell types are different from each other…

A: Cell It is said to be the basic unit of life. Every cell constitutes organelles in the cytoplasm…

Q: . is a type of tissue lines the lumen internal organs and external surfaces of the 1. body,…

A: Nervous system forms a complex part of an animal. It transmits signals to and from different parts…

Q: A soccer player helps maintain stable body temperature during the game by perspiring. The sweat…

A: A stable internal body condition is required for the organ systems to function properly. Proper…

Q: maim functions, input ,output.

A: Metabolism is a process in which food is converted into chemical energy using multiple enzyme…

Q: Cells have different types of RNA.  Explain the three major types of RNA, where they are located,…

A: There are mainly 3 types of RNA  mRNA ( Messenger RNA ) rRNA ( Ribosomal RNA )  tRNA ( Transfer…

Q: Match cells and function

A: Cell differentiation is the process by which the cells become specialized as they body develops…

Q: A classmate says that all of our body cells are pretty much the same.  How should you respond to her…

A: Introduction :- All living organisms are made up of cells, which are the basic building components.…

Q: An epithelial cell in the skin will normally express which of the following? * O D. HLA-DR HLA-DP

A: MHC class II are receptor molecules found on the dendritic cells, B cells, and epithelial cells.…

Q: Skin color is an adaptive trait that provides a) protection against breakdown of folate b)…

A: Pigmentation It refers to coloring of the skin(some areas or patches of skin turn darker in colour)…

Q: Which of the followings is not function of Golgi? O Protein sorting O Lysosomal enzyme tagging O…

A: A eukaryotic cell's Golgi apparatus functions as its “manufacturing and shipping base.” The Golgi…

Q: is a type of tissue lines the lumen internal organs and external surfaces of the body, providing a…

A: Hello! Since you have posted multiple questions, we are answering the first two questions only.…

Q: What details stand out to you? What do these details reveal/suggest?

A: The image appeared in the Leatherneck magazine published by the then US Marine Corps in the year…

Q: You are made of trillions of blank  inside each cell is a blank that stored your blank that…

A: DNA, or deoxyribonucleic acid, is the hereditary material in humans and almost all other organisms.

Q: Epigenetics: are DNA mutations in response to the environment 2) injuries proteins 3) changes the…

A: Genetics is the branch of science which deals in genes and heredity. Study of genetics allow us to…

Q: Which organelle stores the information that determines an individual's hair color

A: In this question, we have answer the name of cell organelle which store the information for hair…

Q: fill in blank

A: The Fovea Centralis is the yellowish central region of the fovea that contains a large number of…

Q: A scientist is studying the genetic material that determines the traits of an individual. In which…

A: The study of how heritable characteristics are transferred from parents to offspring is genetics.…

Q: w can all of a person’s cells contain exactly the same genetic material, yet specialize as bone…

A: Our world is full of biodiversity. Each organism has its own unique characteristics. These are made…