H₂C-O-C-(CH₂) 16CH3 i HC-0- H₂C-O-C-(CH₂) 14CH3 (a) -(CH₂)7CH=CH(CH₂)7CH3 H₂C-O-C-(CH₂) 14CH3 요 HC-O-C-(CH₂)7CH=CH(CH₂)7CH3 H₂C-O-C-(CH₂)7CH=CHCH₂CH=CH(CH₂)4CH 3 (b)
Q: The following are importance of carbohydrates EXCEPT: O carbohydrates are non-polar molecules O…
A: Carbohydrates are polyhydroxy aldehydes or ketones. Depending on their size, they can be…
Q: In a 2017 study examining the efficacy and safety of its use in patients with mild-to-moderate…
A: The given drug has three ionizable groups. It is made up of the amino acid Lys, Pro, and Thr. The…
Q: The active site of chymotrypsin indicates that the following residues are needed: a. Asp and…
A: Chymotrypsin is a digestive enzyme that helps to digest proteins in our food. Chymotrypsin cleaves…
Q: Explain the role that Gla residues play in complexes. Explain the role of vitamin K / warfarins in…
A: Blood coagulation is a complex process where many factors are involved. This factors can be…
Q: 10. Vitamin B6: coenzyme form, functional groups, mechanism of action, biological role, sources,…
A: Enzymes are biological catalysts that catalyse biochemical reactions. Most enzymes are made up of…
Q: f you have 960 nucleotides, how many codons do you have?
A: Introduction DNA is a genetic material of our body. DNA is a self replicating molecule. The…
Q: A peptide has the following amino acid composition: 2 Met, 2 Phe, 2 Glu, 1 Arg, 1 Lys, 1 Val, 1 Leu,…
A: Recall that: Amino acid sequences are written with N-terminal amino acid on the left and C-terminal…
Q: Given the R-groups in the peptide GLY-ASN-THR-LYS-HIS. It would most likely be: a)neither soluble…
A: Different amino acids have different R-groups. The R-groups can be polar or non-polar. Polar…
Q: Based on what you know about what powers ATP synthesis and how NADH and FADH2 interact with various…
A: Introduction Cellular respiration is a process by which glucose molecule breaks and produce carbon…
Q: 2.5 What is Chemio-osmotic gradient, and what is its importance in Metabolism
A: Chemiosmosis is the process by which the ions move by passive diffusion across a semi-permeable…
Q: -Write down the complementary DNA sequence. TACCTAGCG CACATGTAGGTGGGCAAAGTT -Write down the…
A: Note: Hi! Thank you for the question. We are authorized to answer three subparts at a time. Since…
Q: Draw the structure of the following DNA sequence (5’-AG-3’) hydrogen bonded through Watson-Crick…
A: Nucleotides are molecules that have a nitrogenous base (Adenine, Thymine, Guanine, Cytosine and…
Q: Which of the following is true under the following conditions: an enzyme displaying Michaelis-Menten…
A: Enzymes are protein molecules that increase the rate of reaction by million times. Enzymes do not…
Q: HN 2 H₂N-C C 6 3 N C 5 C following nitrogenous bases is represented by this structure? 7 ZI 8 CH
A: The nucleic acids are constituted of nucleotides. The nucleotides consist of a base (adenine,…
Q: Using an arrow, draw the site of cleavage for the following peptides that are reacted by: Pepsin…
A: Amino acids are building blocks of peptides and polypeptide chain. Peptides are consist of 2-50…
Q: Which of the following is correctly classified? O Arachidic (20:0) is a medium chain unsaturated…
A: Fatty acids are carboxylic acids with a hydrocarbon chain ranging from 4 carbon to 36 carbons. The…
Q: 1. What is the effect of boiling in the test tube with starch solution and saliva?
A: Since you have asked multiple question, we will solve the first question for you. If you want any…
Q: L 3
A: Since you have asked multiple questions, we will ask only first question for you. In order to get…
Q: Using an arrow, draw the site of cleavage for the following peptides that are reacted by: Pepsin…
A: Amino acids are building blocks of peptides and polypeptide chain. Peptides are consist of 2-50…
Q: HN₁ O=C₂ G N IZ Which of the following nitrogenous bases is represented by this structure? CH CH 6
A: Nitrogenous bases or nucleotides are the structural components of DNA and RNA. Nucleotides are of…
Q: The side chain of which residue can be hydrogen bond donor: a. Thr b. Ala c. Ile d. Pro e.…
A: There are twenty standard amino acids that makeup all the proteins present in our body. These twenty…
Q: 1. State if true or false a. Gluconeogenesis is the exact opposite of the glycolytic pathway b.…
A: Note: Hi! Thank you for the question. We are authorized to answer three subparts at a time. Since…
Q: Why do some starch products set as they cool?
A: Introduction Starch is a carbohydrate which is commonly found in nature like wheat, rice, potatoes…
Q: 4. General characteristics of water-soluble vitamins as components of human nutrition.
A: Vitamins are the organic compounds required in the diet in small amounts, for performing biological…
Q: ) What would be the predominant ionization states of this amino acid at physiological pH (7.4) and…
A: Amino acids contain an alpha-amino group, an alpha-carboxylic group, and a side chain. The side…
Q: In the alpha-helices, which of the following statement is NOT true? a. Backbone carbonyl…
A: Proteins are composed of amino acids that are attached together via peptide bonds. The linear chain…
Q: Is ATP the only energy that the cell uses/or can use? Justify your answer
A: Introduction Cellular respiration is a process by which cell produces energy rich ATP molecule.…
Q: Does myoglobin have the same high affinity for CO as hemoglobin?
A: Hemoglobin is a multimeric (multi-subunit) protein that transports oxygen from lungs to tissues and…
Q: discuss the biochemistry behind disorders related to aromatic amino acids with an aid of an…
A: The major aromatic amino acids are phenylalanine, tyrosine, and tryptophan. Defect in the enzymes of…
Q: hat is an ONPG test? WHat is he principle behind this assay.
A: Fermentation of lactose happens by bacteria which depends on two enzymes - permease (allows lactose…
Q: The condensation reaction catalyzed by ß-ketoacyl-ACP synthase synthesizes a four-carbon unit by…
A: Malonyl CoA is formed from carboxylation of Acetyl CoA through an ATP consuming process by biotin…
Q: What is one technique or property of a protein that you could use to monitor the fractions so you…
A: In column chromatography, there is a stationary phase and the mobile phase. The stationary phase…
Q: 7. Which of the following statements regarding the regulation of glycogen metabolism is false? A.…
A: In human body, when there is excess of glucose in blood, insulin acts on the hepatocytes and muscle…
Q: For the questions below be sure to show your work as well as the answer to the question. In this…
A: Hi! Thank you for the question. We are authorized to answer five subparts at a time, since you have…
Q: Use the data below to answer the following question: How much more energy is stored in a gram of fat…
A: A heterogeneous class of substances with comparatively similar physical characteristics are referred…
Q: 1.1 Why do you think it was necessary for us to teach you about Metabolism in Biochemistry course…
A: DISCLAIMER FOR MULTIPLE Since you have asked multiple question, we will solve the first question…
Q: Suppose that the thermal denaturation experiment on the protein with the Met to Lys mutation took…
A: pKa is the pH at which a weak acid is 50% dissociated. Changes in pH affect the ionisation of…
Q: Describe the differences between lecithin and cephalin. Draw the structure of a glycerophospholipid…
A: Glycerophospholipids are a class of lipids found in all forms of life. It has Glycerol as its…
Q: draw all the structures of the tribasic amino acid lysine involved in the equilibrium reactions that…
A: The proteins are composed of 20 naturally occurring amino acids. The amino acids can be classified…
Q: Discuss how to determine the elements of proteins and its reactions.
A: Proteins are the most abundant biomacromolecule of life. Proteins are primarily polypeptide…
Q: Which of the following single-stranded DNA molecules are likely to pair with each other to form…
A: DNA are polymers of nucleotides. A nucleotide consists of a nitrogenous base(A, T, G, C) attached to…
Q: HO 0 0 NH₂ НО.
A: The fundamental building blocks of proteins are called amino acids, which are made up of one…
Q: Electron Transport Chain, what purpose does it serve in Catabolic pathway?
A: -Anabolism and catabolism are the two main components of metabolism. - The metabolic process known…
Q: 15. Cellular proteins are oftentimes post-translationally modified. Choose one of the following…
A: Post translational modification are the modifications done in the protein by covalently attaching…
Q: In gluconeogenesis, how is glucose-6-phosphate converted to glucose? is converted to glucose by…
A: Gluconeogenesis is a metabolic process that converts non-carbohydrate carbon substrates such…
Q: Among the given statements, which are characteristics of plant cells? Select the correct…
A: Plant cell has Cell wall as the outermost layer. Cell wall being the outermost layer surrounds the…
Q: The side chain of asparagine contains: OA) a hydroxyl group OB) an amine group OC) a carboxyl group…
A: Proteins are composed of amino acids, which are bound together by peptide linkage. Amino acids…
Q: What is the product of the beta oxidation of this fatty acid?
A: The given fatty acid is caproic acid. Beta-oxidation is the oxidation of fatty acid on the…
Q: Η Η Η Η Η ΤΙΤΙΤ H-C-C-C-CC-G | | | | | Η Η Η Η Η I ОН
A: A functional groups are is a group of atoms that bonds within a molecule and is responsible for the…
Q: What is the physical or structural difference between heterochromatin (also called "heterochromatic…
A: The term "chromatin" describes the DNA and protein combination that makes up the chromosomes present…
Step by step
Solved in 2 steps
- Which of the two structures, (Betaxolol) or (Sotalol) would be more contraindicated to treat a patient with hypertension and a history of depression, sleep disorders or psychosis? cr -o- CH2-CH-CH2-NH2-CH(CH3)2 -H2C-O-H2C-H2C- Он (Betaxolol) CH- -CH2-NH2-CH(CH3)2 OH Cr H3C-S-HN- (Sotalol)Give the name for this molecule: CH,CH,CH,CH,-C-0-H IIBiology Question
- C6H8 + O2 ------à CO2 + H2O How many grams of C6H8 are needed to from 72grams of H2O ?The anomer of a-D-glucopyranose is CH:OH он ÓH CH2OH он он он он CH,OH он он он он CH,OH он OH он ÓH ÇH;OH он он он онThis is remdesivir, one of the drugs being used in the treatment of COVID-19. Label the indicated carbons as R, S, or neither. b); NH2 HO OH
- g) (CH3)₂ - CH₂ -CH-COOH + CH₂-CH-COOH -H₂O NH₂ OH NH₂ 4. Write the equation for the digestion (hydrolysis) of Phe-Asp-Ala. €Which of the following is an anomer of B-D-gulopyranose? O O го ОН H ОН H ОН H H ОН CH₂OH -II- H H ОН ОН CH2OH H ОН ОН CH2OH О 0. H CH2OH то Н H H ОН H H - о H ОН ОН H ОН H ОН ОН H О ОН ОН H NRefer to the given lipid structure: CH,(CH,),,CH=CH-CH-OH CH,OH QH CH-NH-C-(CH,),,CH, CH2 OH 1. Explain what kind of product is formed if NAOH is added to a triglyceride? Discuss the principle of how the product can help in the fight against coronavirus. 2. Discuss why a saturated fatty acid like coconut oil has a good antioxidant property. 3. What are essential fatty acids? Cite some clinical signs of essential fatty acid deficiency. 4. why are essential fatty acids associated with a low incidence of heart disease? 5. what are the physiological effects of prostaglandins? Explain how aspirin can block the synthesis of prostaglandins? 6. In terms of structure, how is cholesterol different from bile salts? Cite causes of bile duct obstruction and symptoms. 7. Explain the cell membrane's lipid bilayer. What are the lipids found in the cell membrane? 8. Differentiate between passive and active transport movement of molecules across the cell membrane
- Provide the correct three-letter abbreviation for the following amino acid: O || H₂N-CH-C-OH I CH₂ CH₂ C=O I NH₂is the structure glycerophospolipid or sphingophospolipid?explain and describe briefly the structure of MgO-NH2-Ru-Pd-Sn (MgO) o-și-(CH,);NH; RuClx -0-Si (CH,);ÑH, -0-Si(CH,),NH, PdCly -0-Si(CH,),ÑH, -0-SHCH;);NH, SnClz -0-Si (CH,);NH;