Hi, I would like to know which program is used for the graphical presentation of the results of a meta-analysis of genome-wide linkage scans?
Q: Which goals of the Human Genome Project do you think are themost important? Why? Discuss the types…
A: The genome of an organism is defined as the whole heredity information encoded in the genetic…
Q: Discuss the sequencing technology used to resolve the human genome in 2005, its significant…
A: Sequencing used in 2005 human genome project.
Q: Why is genome database and annotation relevant to Genome sequencing? Are there any examples?
A: Genome: the set of genes. Genome database: it is the collection of all information on the human…
Q: Examine the “RNA-Seq Coverage” and the “FlyBase Genes” tracks in the Genome Browser from left to…
A: Introduction: RNA is a single-stranded molecule in many of its biological roles and consists of a…
Q: what is Hardy-Weinberg Equilibrium in the Large Scale Genomic Sequencing? how would you summarize…
A: Introduction : Hardy–Weinberg Equilibrium : In The Absence Of Other Evolutionary Factors, The…
Q: what is the main purpose of performing the bioinformatics analysis of 16s rRNA genes lab?
A: Bioinformatics: The application of computation and analysis tools to the capture and interpretation…
Q: List three independent techniques you could use toidentify DNA sequences encoding human geneswithin…
A: A genome is referred to as genetic material of the organism that composed of DNA or RNA. The genome…
Q: Why the DNA sequencing alone is often not sufficient to produce a genome assembly of desired…
A: DNA sequencing is basically the process by which the nucleic acid sequence can be determined. the…
Q: Why Gene-prediction programs are used ?
A: In a DNA sequence, where those codons might fall even where a functional protein might be present or…
Q: Briefly outline the steps of DNA extraction as carried out in a lab for the purposes of sequencing,…
A: Hi! Thank you for your question. We are answering your question on the basic knowledge of the…
Q: What provides a convenient bridge between the low resolution of a karyotype and the ultra-high…
A: Introduction Cytology refers to the study of cell such as cell morphology, physiology etc. As we…
Q: Why a multiple sequence alignment is needed for researchers? What inferences can be derived from…
A: When three or more biological sequences are aligned and studied together, it is referred to as…
Q: What is the difference between using genome build hg18 and hg19 in Genome-wide SNP arrays?
A: SNP (Single nucleotide protein) array is a type of DNA (deoxyribonucleic acid) microarray which is…
Q: What does SDS–PAGE stand for? What is the benefit of doing SDS– PAGE?
A: Electrophoresis is the migration of charged particles under the influence of an electric current.…
Q: What does whole exome sequencing test for?
A: Exomes are part of the genome, which contains only the coding portions of the genes that is the…
Q: What are the possible benefits and dangers of predicting how long a person will live from analyzing…
A: A genome sequence is the study of the genetic makeup of an individual and a whole-genome sequence is…
Q: process of overlap assembly in whole genome sequencing
A: Genome sequencing Genome sequencing or gene sequencing is a way of arranging nucleotides the n the…
Q: Explain the sequencing-by synthesis (SBS) approach ?
A: One of the well-known states that are known as fundamental topics in Arithmetic is sequence and…
Q: in your word, identify one difference one similarity between 16 S sequencing and metagenomic shotgun…
A: With the advancements in science, different techniques have emerged to sequence the genomes of…
Q: Although a number of different animals have been successfully cloned, the process of creating cloned…
A: A living organism, which is genetically identical to that of the other organism is known as a Clone.…
Q: How would you simply explain Protein Analysis (Western blotting)?
A: Proteins, also known as polypeptides, are made up of amino acids. They’re large, complex molecules…
Q: What are some possible research questions and practical applications that could be addressed by…
A: The engineering and manipulation of an organism’s genetic material on the scale of entire genome…
Q: Explain the relationship among the following terms: genomics, proteomics, gene, protein, genotype,…
A: Introduction :- Genomics is the study of an organism's entire genome, which includes genetic…
Q: Why is GenBank important and What is GenBank format?
A: GenBank is the Genetic sequence database at NCBI (National center for biotechnology information). It…
Q: Genetic engineering and gene therapy are similar fields within genomics. What do they have in common…
A: Genetic engineering and gene therapy are similar fields with genomics. They are both similar as they…
Q: The overall goal of the ENCODE Project is a. to sequence the entire genome from many different…
A: The project ENCODE is stands for Encyclopedia of deoxyribonucleic acid (DNA) Elements. It is an…
Q: What are the differences between somatic and germline gene editing? Is there any scientific example…
A: Gene therapy is a widely used technique to treat genetic disorders. There are two types of gene…
Q: Chromosomal microarray, CGH, and Exome sequencing: compare and contrast!
A: In molecular biology many techniques are used for different purpose like PCR is used to generate…
Q: Describe the three basic goals of the Human Genome Project. What are at least three things we have…
A: The HUMAN GENOME PROJECT was a 13-year plant which was proposed by Frank Collins and Roderick. Thee…
Q: Microarray hybridization is used mostly in transcript profiling or assaying DNA variation. Although…
A: A usual microarray technology includes the hybridization of an mRNA with its original template of…
Q: What is Sanger sequencing? Why do we use ddNTP? How to read a DNA sequence gel? c. What is a cDNA…
A: Your question contains multiple sub-parts, and as per our policy, we only answer the first three…
Q: Refer to the figure. What method would you use if you wanted to determine the sequence of the cDNA…
A: cDNA is complementary DNA. This DNA is artificially synthesized from the mRNA template. In genetic…
Q: What is the major difference between the strategies of map based sequencing and shotgun sequencing?
A: DNA sequencing is a process in which sequence(order) of nucleotides in DNA is determined. It…
Q: Consider the following human genetic diseases: hemophilia, Down syndrome, cystic fibrosis, and brain…
A: CRISPR(Clustered Regularly Interspaced Short Palindromic Repeats) Cas genome editing technology…
Q: Let’s suppose you are in charge of organizing and publicizing a databasefor the mouse genome. Make a…
A: Genetics is the branch of biology that deals with the study of genome of an organism and its gene…
Q: Traditional Sanger sequencing has largely been replaced in recent years by next-generation and…
A: BASIC INFORMATION Gene Sequencing It is a process through which the arrangement of of the…
Q: What are the main differences between bottom up/shotgun and top down proteomics strategies?
A: Proteomics studies plays an important role in biomarkers and drug targets. Mass spectrometry (MS) is…
Q: The best molecular technique to quantify the gene transcripts is (write in fu!!).
A: The Central Dogma concept states that "DNA makes RNA and RNA makes protein". This concept is…
Q: Briefly explain why RNA-seq gives more information about the transcriptome than does microarray…
A: Messenger (m-RNA) ribonucleic acid is known to be transcribed from the DNA molecule, which is the…
Q: "DNA Sequence Analysis Relies on Bioinformatics Applications and Genome Databases". Explain this ?
A: DNA sequence analysis is a vital tool in modern biology, allowing us to understand the function and…
Q: Why is genome editing by CRISPR-Cas advantageous over traditionalmethods for creating knockout or…
A: Two crucial components make up the CRISPR-Cas9 system, which modifies DNA. These include the Cas9…
Q: List down and briefly describe three other sequence alignment tools other than BLAST used in…
A: BLAST can rapidly align and compare a query DNA sequence with a database of sequences, which makes…
Q: What are the advantages of human genome project?
A: The genome of an organism is defined as the whole heredity information encoded in the genetic…
Q: Are you in favor of OR against human genetic editing? Do you believe that there are appropriate…
A: Gene editing is a group of several technologies that scientist to change the organism's DNA.
Hi, I would like to know which program is used for the graphical presentation of the results of a meta-analysis of genome-wide linkage scans?
![](/static/compass_v2/shared-icons/check-mark.png)
A genome wide linkage association study (GWAS) is an approach used in genetic research to associate specific genetic variations with particular diseases.
Procedure for meta analysis of Genome wide linkage scans involves different steps:
Meta-analysis method involves scanning of genomes from many different people and looking for genetic markers that can be used for prediction of presence of a disease.
Step by step
Solved in 4 steps with 1 images
![Blurred answer](/static/compass_v2/solution-images/blurred-answer.jpg)
- what is the whole-genome shotgun sequencing? Also briefly explain its strategy to assemble the genome sequence.Transcriptome analysis involves two separate methodologies: gene expression and RNA seq analyses. The 10 items below are a scrambled listing of the steps used in the two procedures. Identify the steps involved in RNA seq from the list below. Use the numbers in the list to refer to each step. Once the steps for RNA seq have been identified, write the steps in the order in which they are performed during the experiment. (1) DNA sequencing (2) Allow for hybridization and wash excess cRNA. (3) Mix labeled cRNA with array chip. (4) PCR amplification (5) Measure fluorescence intensity to determine abundance of transcripts. (6) Add labeled cRNA at each microarray location. (7) Map cDNA sequences to the genome of the organism to determine identity and abundance of transcripts. (8) mRNA isolation from cells (9) Prepare fluorescently labeled cRNA probes (10) cDNA synthesisWhy is genome database and annotation relevant to Genome sequencing? Are there any examples?
- Microarray hybridization is used mostly in transcript profiling or assaying DNA variation. Although the technology for establishing DNA microarrays was developed only recently, numerous applications have already been developed and their impact on future biomedical research and diagnostic approaches is expected to be profound. Give some examples of the practical use of this technique.Which sequence variations are identified by NGS and in which format they are store Discuss in details the software used to identify the effect or nature of these variants. How this information can be used for personalized medicine.From your knowledge about DNA microarray, answer the following: A- How DNA microarray is created? and why it is referred to as “hybridization technology”? B- Why RT-PCR is important in the sample preparation to perform expression microarray experiment? C- Mention the name and the color of the dyes used in expression microarray? D- If the expression microarray experiment was done with a normal sample and a suspected sample, after reading the color pattern resulted from the experiment it was recorded that “gene A22” is expressed in the suspected sample. The gene A22 is clinically linked to colon cancer. Answer the following: What is the expected color of the spot on the microarray which represents this gene? What is your interpretation of the suspected sample; is it a cancer sample or not and explain why?
- Why are closure and completeness important in genome sequencing?What is a repetitive element in genomics? What are the types of repetitive elements? What is their effect on the ease of determining and analyzing a genome sequence?As a technique for detecting genetic variations, RFLP has substantial drawbacks. Name one such drawback, explain why it is unique to RFLP analysis with specific reference to the technique, and discuss why DNA sequencing overcomes this drawback. Please leave the link for any sources used. Thanks!
- Whole-exome sequencing (WES) is helping physicians diagnose a genetic condition that has defied diagnosis by traditional means. The implication here is that exons in the nuclear genome are sequenced in the hopes that, by comparison with the genomes of nonaffected individuals, a diagnosis might be revealed. (a) What are the strengths and weaknesses of this approach? (b) If you were ordering WES for a patient, would you also include an analysis of the patient’s mitochondrial genome?Let’s suppose you are in charge of organizing and publicizing a databasefor the mouse genome. Make a list of innovative strategies you wouldinitiate to make the mouse genome database useful and effective.Design a oligonucleotide probe for provided gene sequence using all the guidelines for efficient probe designing. ACAACCCCAAGCCTTCAACCACCCCCTTCCCCCAAATTAGAGATCGATCTCAAGAAGAAGAATGGGTTCCGTCTCTCGCTCTTCTTTGGATCAGAAGCTGGCCATGGCAAAGCGCTGCTCCCACGAGGGAGTTGTCGCGGGAGCAAAGGCGGCCGTGGTTGCAACTGTTGCCTCGGCCATTCCTACTTTGGCTAGCGTTAGGATGATCCCATGGGCGAGGTCCTTCCTTAATCCCGCAGCTCAGGCCCTCATCGTTTCATCAGCGGCGGGGGCGGCGTACTTCATAGTTGCGGACAAGAC