how do we maintain a steady support of amino acids in the body?
Q: Describe the structure of amino acids, and explain how their sequence in proteins affects the…
A: Amino acids are building blocks of proteins and consist of carboxyl group, amino group, side chain…
Q: Which of the following amino acids are considered as both glucogenic as well as ketogenic amino…
A: Those organic molecules which possess two functional groups carboxylate and amino group and a…
Q: What is the importance of glucose-6-phosphate for metabolism
A: The cellular processes take place in a stepwise manner with the help of several metabolic reactions…
Q: Which non-essential amino acid may be considered essential for infants, elderly and for people with…
A: Nonessential amino acids are amino acids that can be produced in our body using the glucose from our…
Q: importance of proteins
A: Proteins are composed of amino acids which are required for the various metabolic processes in the…
Q: Why are certain amino acids defined as essential for human beings?
A: Amino acids are the biomolecules which are important for the synthesis of proteins. Amino acids are…
Q: what is not an aminoglycoside?
A: Aminoglycosides are a class of anti-infection agents utilized widely in the treatment of aerobic…
Q: What difference would it make in food processing and nutrition if an individual ate a diet composed…
A: As we know that amino acids contain carbon ,hydrogen, oxygen and nitrogen and serve as monomers of…
Q: What characterizes the C5 amino acids? These amino acids are converted to glutamate then deaminated…
A: Introduction: Amino acids are compounds that contain an amino group, a carboxyl group, and a side…
Q: Why are some amino acids called essential?
A: Amino acids are the organic components that will unite to produce a protein. They serve as the…
Q: How do polysaccharides work? What is their role?
A: Poly means" many" and saccharides means "carbohydrates", so polysaccharides are carbohydrate…
Q: What is phenylketonuria? Discuss its occurrence, symptoms if any, treatments if there are, and any…
A: The pattern of inheritance of a condition caused by a recessive faulty gene copy located on an…
Q: Which of the following amino acids are catabolized to pyruvate? (more than one answer)
A: Catabolism means breakdown of molecule. Pyruvate is a three carbon compound and is involved in…
Q: (a) What is protein turnover? Give 1-2 examples. (b) What are the main differences between…
A: There are four different levels for the proteins. These levels are: Primary structure secondary…
Q: What is the deficiency of Vitamin B6 and how does it affect amino acid metabolism
A: Water-soluble vitamin B6 is mostly present in many foods, including meat, fish, , beans, grains,…
Q: is it possible to get a sufficient supply of nutritionally adequate proteins by eating only…
A: Proteins play an important role in healthy and balanced diet. Without sufficient amount of…
Q: How are lipid molecules such as estrogen and β-carotene related to each other? What biosynthetic…
A: The lipid molecule such as estrogen and b- carotene are both derived from the biosynthetic pathway…
Q: Can an amino acid be both glucogenic and ketogenic? Explain why or why not.
A: The the amino acid is the basic subunit of the protein, which helps to form protein functional…
Q: What are the essential amino acids? Name all of them and its structures.
A: Amino acids are the building units of proteins. An amino acid has a central carbon atom which is…
Q: Why are fats a concern when eaten in excess amounts?
A: The “Food and Nutrition Board” of the national university establishes the guideline of recommended…
Q: If phenylalanine was not an essential amino acid, would diet therapy (the elimination of…
A: Phenylalanine is an essential amino acid. Essential amino acid are those amino acids that are not…
Q: Why is rubisco likely to be the most abundant protein in nature?
A: Proteins are organic biomolecules that play an important role in various biological cellular…
Q: What components of the fat in this figure make it a triglyceride?
A: : lipids or fats are a type of biomolecules along with carbohydrates, proteins ,fats Minerals and…
Q: Tyrosine is a nonessential amino acid in humans. Under what circumstance would it become an…
A: Amino acids are biomolecules serving as the building blocks of proteins. These have a carboxylic…
Q: chain of amino acids
A: The amino acid is an organic compound from which proteins are made. It contains two functional…
Q: How are carbohydrates "protein spring
A: The process by which the body derives energy from sources other than protein is called protein…
Q: How many amino acids, commonly found in nature, are utilized for protein biosynthesis?
A: Proteins are polymers and are one of the most important macromolecules in all living organisms.…
Q: how do we maintain a steady support of amino acids in the body?
A: 1. Amino acids and proteins are the building blocks of life. When proteins are digested or broken…
Q: How does fatty acid synthesis in plants differ from fatty acid synthesis in animals?
A: Fatty acids refer to a type of carboxylic acids that have a saturated or an unsaturated aliphatic…
Q: Which of the following amino acids is the least abundant in proteins? O v W F A G
A: The structural monomers that hold the protein together are amino acids. Proteins are made up of 22…
Q: how can a diet that is 90% carbohydrates support the same amount of protein in the human body as a…
A: In living organisms, several molecules are there. These molecules have different functions. In…
Q: What effects do the 21st and 22nd amino acid have on proteins
A: Organic compounds that bind to form proteins are amino acids. The building blocks of life are amino…
Q: Determine the pKa of the amino acid using the graph graph attached:
A: Amino acids contain amino group and carboxyl group along with R side chain. The R side chain defines…
Q: Why might it be a bad idea to take large quantities of a single amino acid dietary supplement?
A: Amino acids are biological compound which has 4 groups attached to it- The R group, The carboxylic…
Q: What do you mean by aminon? State its function.
A: In a multicellular organism, the embryo is the early developmental stage. It refers to the part of…
Q: What does hydrogenation do to fat? What are trans-fatty acids? In what types of foods are trans-fats…
A: The procedure of mixing fat with hydrogen to making it more saturated is known as fat hydrogenation.…
Q: What does it mean when a person is lactose intolerant? Biologically, what causes this? How can it…
A: Lactose intolerance occurs when our bodies are unable to digest or break down lactose. Lactose is a…
Q: Explain why all mono- and disaccharides are soluble in water? What are some examples of artificial…
A: All mono- and disaccharides are soluble in water. Monosaccharides are glucose, fructose, and…
Q: Approximately how many calories are in a banana that has 20 grams of carbohydrate?
A: There are 18 calories in a banana that 20 grams of carbohydrates
Q: symptoms of phenylketonuria (pku) may be minimized or suppressed by a diet low in ___. protein…
A: A genetic mutation caused in a gene which encodes an enzyme that degrades the amino acid…
Q: What are the essential amino acids? Name all of them and draw its structures
A: Essential amino acids cannot be made by the body. They must be come from food.
Q: quantitatively measure the concentration of carbohydrates
A: Benedict's test is mainly used for detection of reducing sugar in the given analyte solution. It is…
Q: Give other health problems associated with amino acid aside from Kwashiorkor disease? Give a short…
A: Aminoacids are the monomer units of proteins. Aminoacids are joined by peptide bond to give linear…
Q: How are the fats digested in body ?
A: Fats are the form of lipids , one of the macronutrients essential for vital functions in the body…
Q: What do we mean by essential and non-essential amino acids?
A: Amino acids can be defined as those organic compounds which combine to form protein biomolecules.…
Q: Determine the difference between ketogenic and glucogenic amino acids.
A: Amino acids are organic acids with a single alpha carbon to which various substituents such as an…
Q: What is a glucogenic amino acid? Give three examples.
A: The Fate of carbons in amino acid degradation involves in the classification of amino acids into two…
how do we maintain a steady support of amino acids in the body?
simple and concise answer please
Step by step
Solved in 2 steps
- how do we maintain a steady support of amino acids in the body?Detection of the enzyme aminotransferase in the blood is used to diagnose: O kidney damage pancreas damage O liver damage Question 24 Not all amino acids require transfer of the amino group to a-ketoglutarate for their deamination True Falsehow many amino acids are in CAGATTGTGAAGAGGTCTCTTGA peptide sequence? Answer in numerical digits only
- What are the essential amino acids and how does the body get them? Give an example of one of them and how it can be obtained. Briefly discuss why they are important to overall health and the consequences (health disorders) if they are missing from the diet. Why is a protein's structure important? What can happen if there are any changes? Provide an example and cite sources.This amino acid is called COOH CO0 CO0 H3N-CH H,N-CH H&N-CH H2N-CH CH2 pK, CH2 CH2 pKR CH2 pK2 CH2 CH2 CH2 CH2 СООН СООН CO- IV Histidine Glutamic acid Aspartic acid Valine IsolucineWhat's the difference between whole-wheat bread and whole bread when it comes to complex carbohydrates?
- The term nonessential amino acids is applied to amino acid that are -- -synthesizedin the body -water soluble -required by the body but not essential -uselessDescribe some general differences between fat-soluble and water-soluble vitamins. no handwritten answers pleaseAmino acid degradation and biosynthesis are related metabolic processes, but they are not identical. Indicate two ways in which they are similar and one in which they are different. Be as specific as you can.