How long can you wait after droppingfood on the ground to eat it withoutit'shaving germs attached? Somesaya five-second rule, others say ten.

5-second rule! Almost everybody has dropped some food on the ground and still needed to eat it. If…

Answered: How long can you wait after dropping…

How long can you wait after dropping food on the ground to eat it without having germs attached? Some say it's a five-second rule, others say ten.

Health Safety And Nutrition F/Young Child

9th Edition

ISBN:9781305144767

Author:MAROTZ

Publisher:MAROTZ

Chapter15: Feeding Infants

Section: Chapter Questions

Problem A5CR

See similar textbooks

Related questions

Q: Explain in 500 words, the health policy in Benin country?

A: The Republic of Benin or Benin is located in western region of African continent.

Q: The locations of numerous lacI - and lacIS mutations have beendetermined within the DNA sequence of ...

A: c. LacIs is a trans-dominant mutation that stops transcription in both operons. Only the genes cis t...

Q: Comparison to Human Arm in Form Comparison tó Human Arm Animal Function in Function vhale cat pat pi...

A: Homologous structures : These are the structures which are common in form but differ in function. Th...

Q: Humans are heterodonts, which means they Group of answer choices have different types of teeth multi...

A: Human beings are highly evolved organisms that have a better thinking capacity. Humans share more co...

Q: Please complete the following question: (attached is the question & the table)

A: Nitrogen, Potassium, Calcium, Magnesium, and Phosphorus all are essential elements for the growth an...

Q: Are the morphological characteristics of a sponge enough to identify it up to the genus level? Why o...

A: The morphological characteristics of a sponges are used to identify it up to the genus level but mor...

Q: B. ANALOGOUS STRUCTURES DIRECTIONS: Study and compare the butterfly wing and the bird wing below. Th...

A: In the evolution the structural similarities and differences between different organisms helps us id...

Q: How do we know that the lac repressor is a protein?

A: Lac repressor protein is encoded by the lac I gene.

Q: 8:25 Screenshot_2021120 What I Can Do Activity 6. What is your stand? Directions. Below are some of ...

A: A genetically modified organism (GMO) is any organism whose genetic material has been altered using ...

Q: Which parameter from the software must you adjust in order to permit gene flow? Starting frequency ...

A: Definition: Gene flow is the movement of gene from one organisms to another one. It can be in a hori...

Q: Thomas Malthus argued that human populations grow faster than the resources they depend on true or ...

A: Evolution is the gradual process, Biodiversity is the result of evolution. Evidence for evolution ca...

Q: What do non-parasitic lampreys do?

A: Answer

Q: discuss the implications of the results obtained and include in your report all the data (eg. graphs...

A: Island biogeography is a field within biogeography that says that a larger island will have large nu...

Q: The ____________ are used for grinding and chewing. Group of answer choices Canines Molars No answer...

A: Answer- Molars #Molars are used for grinding and chewing

Q: List out Bone loading bearing's material properties (

A: ✓Bone mineral is a ceramic material and exhibits normal Hookean elastic behaviour, i.e. a linear str...

Q: How might you be contributing directly or indirectlyto the annual dead zone that forms in the Gulf o...

A: Algae can develop to dangerous levels when there is an overabundance of nitrogen and phosphorus in t...

Q: coenzyme and cofactor

A: Coenzymes are small, non-protein organic molecules that carry chemical groups between enzymes . Cofa...

Q: Question is attached

A: The lac operon is an Operon or a collection of genes with a single promoter. The genes in the operon...

Q: On which sex is the mandible tip (or the chin) squarer? a. males b. females c. on both sexes d. ...

A: According to many studies researchers have found that Mandible tip (or the chin) squarer is the resu...

Q: O 19% O Cannot determine O 62% O 38% O 31% OoooO

A: According to the chargaff's rule, we know that the purine bases and pyridine bases are present in ra...

Q: What is the immediate energy source for active transport?

A: The movement of molecules across a cell membrane across a concentration gradient from a lower concen...

Q: B. Encircle Monophyletic groups that can be found in this tree. Angus cattle White-tailed deer Blue ...

A: Phylogenetic tree is a diagrammatic representation which evaluates how the taxons are closed related...

Q: Solutes tend to diffuse from a region where they ar_____ concentrated to an adjacent region where th...

Q: Do all cells contain DNA? Explain your answer.

Q: Explain how fungi are able to reproduce so effectively and so abundantly. Your answer

A: Fungi (singular: fungus) are a kingdom of generally multicellular eukaryotic creatures that are hete...

Q: which lampreys are parasitic and which are not in the Great Lakes?

A: The Great Lakes is a series of large interconnected freshwater lakes in the mid-east region of North...

Q: Distrubuting areteries possesses more smooth muscle in tunica externa? yes or no

A: Arteries are constantly under stress. The aorta and pulmonary arteries, which are closest to the hea...

Q: 13. Give 2 reasons why is meiosis a source of genetic variability for organisms? 1. 2. 14. How many ...

A: INTRODUCTION In genetically , the cell reproduction occur the identical copies of cell growth and...

Q: Provide one example of the Fusiform Face Area

A: The fusiform Face Area in simple terms means spindle shaped area. It is also known as fusiform gyrus...

Q: Which of the following is not a function of proteins? a. transport molecules b. acting as messenge...

A: Introduction:- Proteins are big, complex molecules that play a number of important tasks in the huma...

Q: phylogenetic tree?

A: Phylogenetics is a branch of biology that deals with studying and determining the evolutionary relat...

Q: If a species looks superficially the same after thousands of years, the most likely explanation is: ...

A: Introduction:- Convergent Evolution occurs when thousands of years pass and a species appears to be ...

Q: What are two important points that are required for both host and viral DNA replication?

A: Viruses lack cell machinery. Since viruses lack their cell machinery, they completely depend upon th...

Q: Deuterostome animal phylogenetic tree

A: A phylogenetic tree, also known as a phylogeny, is a diagram that depicts the lines of evolutionary ...

Q: A cat eats a bird, which ate a caterpillar that chewed ona weed. Which organisms are autotrophs? Whi...

A: Autotrophs are almost all green plants that make their own food. They have a special mechanism to ma...

Q: Why would adults be more likely to have an allergy to an insect venom than a child? Give one hypoth...

A: Anaphylaxis is a severe allergic reaction, which occurs in body as response to insect venom.

Q: what does rennin do in the context of food?

A: Rennin also called as the chymosin is the protein digesting enzyme that curdles the milk by transfor...

Q: Define osmosis and solve simple problems involving osmosis; for example, predict whether cells will ...

A: Osmosis does the following things. Osmosis affects nutrition delivery and the release of metabolic ...

Q: . An oligonucleotide (a short DNA or RNA) has the following sequence: ACGTGGTTCCATGGTACGGC (a) Show ...

A: The malting temperature (Tm) of the DNA is the temperature at which at least 50% of dsDNA is conver...

Q: What is the experiment that helped Hershey and Chase recognize DNA as a genetic material? Explain in...

A: Introduction: The undeniable proof that DNA is the genetic material reached from the experiments of ...

Q: Please help explain this Vpr counteracts the LAPTM5 mediated degradation of HIV-1 Env

A: HIV-1 accessory protein Vpr enhances infection in macrophages but not in CD4+ T cells remains elusiv...

Q: 74. Copy Table 2 into your notebook. List three types of steroid molecules, and explain their purpos...

A: INTRODUCTION STEROIDS Steroids are lipids. They are hydrophic and it is insolubl...

Q: Describe how a natural disaster can create an ecological disturbance, and how this can impact biodiv...

A: A geographic area where plants, animals, and other organisms, as well as abiotic factors work togeth...

Q: What would be the sequence that the RNA polymerase synthese from the follwing DNA sequence? 5' ACCT...

A: Transcription: The process of formation of RNA from the DNA by action of DNA dependant RNA polymera...

Q: a 60-year-old Patient was taken to the hospital by ambulance for an obturation intestinal obstructio...

A: Intestinal obstruction is a blockage that keeps food, or bowel passing through small or large intest...

Q: 1. Gradualism is the theory that the earth’s features are the result of long-term processes that con...

A: In 1858, Charles Darwin and Alfred Russel Wallace released "the Origin of Species", which detailed D...

Q: In cats, fur color is a sex-linked trait, where black fur is dominant over yellow fur. If a calico f...

A: The coat color of cat is an X-linked trait. Males are hemizygous (one X chromosome and another Y ch...

Q: importance of maintaining aseptic conditions

A: Aseptic means the absence of germs, such as bacteria, viruses, and other microorganisms that can cau...

Q: 1. Construct a map for the genes d,e,f. Assume that: d and e = 3%; e and f = 5%. Give 2 arrangements...

A: Gene is the sequence of nucleotides in DNA which encode a particular protein.

Q: 3. Explain the term Refractive Index (n) of liquids, and describe how the values may be measured exp...

A: Refractive index It determines how much light is bent, or refracted when entering a material. When l...

Question

How long can you wait after dropping
food on the ground to eat it without
it's
having germs attached? Some
say
a five-second rule, others say ten.

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

SEE SOLUTION Check out a sample Q&A here

Step 1

VIEW

Step 2

VIEW

Step by step

Solved in 2 steps

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.

Similar questions

There are two, two sided dishes in the pillbug experment. In one dish, should have placed sand in both sides. In the other dish, you should have placed ___ in one side and ___ in the other.a). cornstarch; constarchb). cornstarch; pillbugsc). sand; pillbugsd). sand; cornstarch
What is prophylaxis?
Can you be more specific please?
A 37 year old male comes to a free clinic in the middle of a metropolitan city. He said he does not like to use free services, but he has a skin condition that won't heal. The patient takes off hios right shoe and the doctor believes it is necrotizing fascilitis. The patient said he had a bad case of frost bite over the winter, and it just will not heal. a. What type of specimen should you collect? b. What type of precautions should be made immediately? c. What is the species of bacteria that most likely caused this condition? What group is it in? d. Now that you know the species, how would you discern the strain? e. List one rapid test and one more traditional testing method.
A hiker who got lost in a forest for a week returns in good health. She had to survive by eating and drinking whatever she could find in the forest. She returns in good health, but complains of diarrhea. Which disease below can you most likely rule out? O Aspergillosis O Toxoplasmosis O Dysentery O Giardiasis Salmonellosis
A newly pregnant mother visits the maternal health clinic and asks about what foods she should avoid to prevent her susceptibility to foodborne illness. What foods are pregnant women recommended to avoid in order to prevent Listeria monocytogenes? asap please
Many thylakoids make up a grana. O True O False
Can germs live on nail polish
How does a fever influence bacterial pathogens? O They grow faster because they are thermophiles O They will generally grow slower O It makes oxygen more available to help the bacteria grow O It helps them progress through lag phase
How do you know if you Rhizobium isolation was successful? Could you please list all indicators. Thanks you
Which of the statements is true? O Food spoilage is a common source of human infections O Food spoilage makes the food appear, taste or smell different O Food spoilage makes the food appear, taste or smell normal. Only bacteria can cause food spoilage Only fungi can cause good spoilage
Historians report that 2500 years ago the Chinese learned to treat superficial infections such as boils by applying moldy soybean curds to the area. Can you suggest what this implies? - Please dont use the same answer that is already posted.