How many H2O particle were produced by creating the following How many peptide bonds were produced by creating the following structure if the starting reagent is glucose? * structure if the starting reagent is glucose? * CHOH CHOH 1 CHOH CH;OH CH,OH CH,OH OH OH 250 OH он он он OH он OH Он 300 A.) 125 О в.) 250 A.) 30 C.) 25 B.) 301 D.) 500 С.) 302 O E.) O O D.) 300 E.) 150 O O O
Q: In general, proteins can be classified into 3 different groups. Name and give a short description of...
A: Proteins are considered as large biomolecules and also a macromolecules which comprise one or more l...
Q: List down the 25 different antibiotics and give the mechanism of action
A: Antibiotics, also known as antibacterials, are medications that either kill or slow the growth of ba...
Q: How many mL of 0.254 M NaOH are needed to fully react with 37.50 mL of 0.358 M H2SO4?
A: Concentration of the NaOH = 0.254 M Conc. of H2SO4 solution = 0.358 M or conc. of [H+]=2×0.358 M =0....
Q: Lipids are defined by property rather than structure. What is the “defining property”?
A: Lipids are biomolecules made up of Carbon hydrogen and oxygen. Sometimes they also contain phosphoro...
Q: 2. You have made a mutation in myoglobin that increased the Pso for O2 by a factor of 2. Sketch out ...
A: Myoglobin is a non-allosteric enzyme found in muscle cells. The main function of myoglobin is to sto...
Q: Identify the two buffer systems in the tubular fluid that carry excess hydrogen ions into the urine ...
A: The nephrons are microscopic structures and are the structural unit of the kidney that are constitut...
Q: 1-isopropylmalate to 2-isopropylmalate (s
A: here we see the biosynthesis of leucine as it involves the conversion of 1-isopropylmalate to 2-isop...
Q: While performing the Biuret test, a student added HCl instead of NaOH. How will a resulting solution...
A: Biuret test is the specific test for the identification of proteins in a sample solution. Biuret rea...
Q: Complete the following chart about PDHK activity by determining if the molecule would be in high or ...
A: Pyruvate dehydrogenase kinase (PDHK) is a kinase enzyme that is very important to regulate the activ...
Q: CH,OH Он ÓH ÓH
A: The cyclic forms of carbohydrates can exist in different configuration based on the position of the ...
Q: Which statement below best describes the main difference between how scientists define data and hypo...
A: Scientific Hypothesis is a part of scientific method which consists of 6 different steps. Scientific...
Q: What do you think will happen if the melting temperatures of the PCR primers (forward and reverse) a...
A: PCR (Polymerase Chain Reaction) is a technique, which is used to amplify a small fragment of DNA and...
Q: Ribosomal RNAs (rRNAs) are another example of a functional RNA molecule. Based on Figure 9-11, what ...
A: Molecules of rRNA are synthesised in the nucleolus, a specialised part of the cell nucleus that appe...
Q: What is annealing?
A: PCR involves three important steps denaturation, annealing and extension. PCR is used for DNA and RN...
Q: Match the outcomes on the left with the laboratory steps on the right. ___ Harvest the cells ...
A: Introduction: DNA isolation is a process of purification of DNA from samples using a combination of ...
Q: the different individuals involved in a clinical laboratory (their job specification -qualification,...
A: JOB SPECIFICATION Laboratory Director QUALIFICATION and TRAINING Doctoral degree (e.g., MD or ...
Q: Calculate the approximate molecular weight of a protein composed of 303 amino acid residues in a sin...
A: Amino acids contain amino group and carboxyl group along with R side chain. The R side chain defines...
Q: Describe monosaccharide, disaccharide, oligosaccharide, and polysaccharide in terms of the number of...
A: Biomolecules refer to carbon- based organic compound that are produced by a living organism. These c...
Q: 32. Which one of the following is NOT a typical characteristic of the active site of an enzyme? A) T...
A: Substrate molecules bind to the enzyme, which then undergoes a chemical reaction. The active site is...
Q: What is the importance of studying the variety, sequences, and amounts of mRNA produced in the cell?
A: A single-stranded RNA molecule that corresponds to a gene's genetic sequence and is read by a riboso...
Q: Why was there a greater A260 absorbance reading for your DNA sample that was incubated at higher tem...
A: Hyperchromicity is the increase in optical density of a substance at a particular wavelength.
Q: RNA- degrading enzyme.
A: RNA is ribonucleic acid. It is single stranded. It has four bases adenine, guanine, cytosine and ura...
Q: Which of the following is TRUE about the enzymatic catalysis of a chemical reaction? A. It increase...
A: Enzymes are the biological catalysts that increase the rate of reaction by lowering the activation e...
Q: Given that the reduction potential Eo'= -320, +10, +816, and +50mV for NAD+, fumarate, 02 and G3P DH...
A: NAD+ oxidises glyceraldehyde 3-phosphate, incorporating inorganic phosphate (Pi) to create 1,3-bisph...
Q: Which of the following is TRUE? Select one: a. The disulfide bridges formed by oxidation of the sulf...
A: The tertiary structure of the proteins is due to various interactions between the side chains in the...
Q: 2. Roughly sketch the hydropathy plot for the given hypothetical membrane protein. Follow the color ...
A: The amino acids can be classified based on the polarity of the side chains to form a scale called th...
Q: 14. Subject this amino acid sequence under (1) trypsin (2) chymotrypsin (3) pepsin and (4) CNBR. Gen...
A: Trypsin, chymotrypsin, and pepsin are proteolytic enzymes, which help to cleave complex proteins int...
Q: 2. Enzyme X has an optimum pH = 9.5. Which buffer solution below is the most appropriate to maintain...
A: pH is the measure of the strength of H+ ion or Hydronium ions in solution. pOH is the mea...
Q: An enzymatic reaction was carried out in a batch-operated reactor until exhaustion of the substrate....
A: Enzyme kinetics is a study of enzyme catalyzed biochemical reaction using plotting the graph Substra...
Q: Given a tripeptide Cys-His-Lys, Cys: Pk1 = 1.71; Pk2 = 10.78; PkR = 8.33 His: Pk1 = 1.82; Pk2 =...
A: The pKa values of amino acid side chains that constitute a protein play an important role in definin...
Q: You are studying the rate of transcription of a particular eukaryotic gene. When the DNA located sev...
A: Transcription is copy of genetic information from DNA to RNA. Eukaryotic transcription is more compl...
Q: How is hemolytic anemia related to pentose phosphate?
A: Introduction: It is anemia due to hemolysis of red blood cells that occurs either in the blood vess...
Q: How much ATP and CO2 can be derived from 500 g of lactose?
A: Lactose is a sugar that is found in milk. Lactase is an enzyme that helps our systems absorb sugar b...
Q: Assume that mitochondria contain 0.35 Molar KCL and 0.012 Molar NaCl. Calculate the grams per liter,...
A: Osmolarity is defined as the concentration of a solution expressed as the total number of solute par...
Q: What is the process and principle behind isoelectric precipitation?
A: Isoelectric precipitation is a type of isoelectric precipitation that occurs when: The pH of a solut...
Q: Compare and contrast the following protein characterization techniques in terms of the principles go...
A: A Physical method for the separation of compounds is called chromatography. In two diff...
Q: A mixture containing glutamic acid, arginine, phenylalanine and valine was subjected to anion exchan...
A: Amino acids differ from each other on the basis of their side-chain properties. There are twenty sta...
Q: Which disaccharides do not have reducing ends? sucrose and maltose sucrose and trehalose O trehalose...
A: Any material made up of two molecules of simple sugars (monosaccharides) bonded together as a disacc...
Q: Aldosterone is glucocorticoid hormone with Na+/K+ balance i the human body. Cortisol is an adrenocor...
A: The hormones in the body play a central role in maintaining key homeostatic processes in the body.
Q: 6. Why would the lack of lactase cause Carol so much distress? Where would the undigested lactose tr...
A: Lactose is the principle carbohydrate present in milk and consists of two sugars, glucose and galact...
Q: The data in the table below were collected during a laboratory session assaying for the kinetics of ...
A: Acid phosphatase is a lysosomal enzyme released by many cells/tissues type. Some cells release high ...
Q: Diagram generally how a mRNA that contains sequences corresponding to four (4) exons would be transl...
A: In eukaryotes, genetic information is encoded in DNA is transcribed first as pre-mRNA strand. This p...
Q: OTE: explain in a paragraph form How does PCR help in the identification of the virus from patients...
A: Polymerase chain reaction is a molecular biology technique for making a large number of copies of a ...
Q: . What can you infer regarding the function of Aquaporin 3? b. How will the drug treat constipation?...
A:
Q: Modified TRUE or FALSE. Write the word TRUE if the statement is correct. If the statement is false, ...
A: Proteins are made up of amino acids, which are a type of molecule. The basic components of life are ...
Q: Which of the following could be the DNA template for the following protein primary structum Methioni...
A: In order to form a polypeptide chain, amino acids are linked together in a sequence. During protein ...
Q: Prolamins are proteins soluble in water and dilute aqueous solutions
A: With respect to the solubility of a protein in water the globular proteins are more soluble than fib...
Q: Which of the following pairs of sugar/s and description is/are INCORRECT? * A. Xylose: Glycoprotei...
A: Monosaccharides are the simplest form of carbohydrates. They can be either aldose (aldehyde as the f...
Q: During gaseous transport, the chloride ions shifts from _______ to _______ to maintain the ionic bal...
A: During respiration(internal), the chloride ions shift from plasma to RBC to maintain ionic balance. ...
Q: Protein Description A 35 kDa monomer Disulfide-linked homodimer comprised of 19 kDa monomers homodim...
A: Answer - Protein is made by amino acids and in living organisms, 22 types of amino acids exist and...
Step by step
Solved in 2 steps
- A) Refer to the figure below, Identify and explain the two types of reactions, and describe what are the importance of these reactions to our bodies. Reaction 1 H Monomer Reaction 2 H H OH + H H H₂O H H₂O OH + H H OH OH + H H₂O H₂O OH OH + H OH OH OH OH B) What are the main chemical interactions that determine and maintain the quaternary structure of proteins. Also, what are the conditions that can alter these interactions? [How many H2O particle were produced by creating the following structure if the starting reagent is glucose? * CH,OH CH,OH CH,OH OH OH OH ÓH ÓH 300 O A.) 30 О в ) 301 О с) 302 O D.) 300 O E.) 150 O F.) Oa) A solution of amino acid having carboxylic side chain was titrated against NaOH. If initial pH of the solution was 2.8. Describe the state of the functional groups of the amino acid at the initial pH and at 10.5.b) Briefly explain how you will separate amino acids mixture using the charge difference between the amino acids.
- (a) Draw the structure of ninhydrin. (b)Write the complete equation for its reaction with amino acids. (c) What is the substance responsible for the purple colour produced upon reaction of ninhydrin with an amino acid?1)Ubiquitin is a small protein with a monoisotopic mass of 8560 Da. a) Electrospray ionization of this small protein typically results in major charge states of +8, +9, +10, +11, +12, and +13. Using this information, complete the table below, assuming the charges on each come from protonation. Report mass and m/z values to the ones place. b) Using the data you entered in the table, sketch an expected ESI-MS spectrum for ubiquitin. Label each peak with its charge state. What do you notice about the spacing of peaks along the x-axis. c)The figure shows an experimentally obtained electrospray mass spectrum for ubiquitin. Compare this spectrum to the spectrum you predicted. Are there any differences? If so, what might cause these differences?Select the term in column B which best matches the description in column A. There are more terms then needed. Column A Column B 1. The pentose sugar found in DNA. a) Cis fatty acid b) Trans fatty acid c) Coenzyme d) Cofacipr 2. Commonly referred to as "insoluble fiber". 3. Considered to be an amphipathic molecule. 4. A molecule with the formula C18H3602 is probably a e) Phospholipid 5. Bond created during the formation of the primary structure of a protein. ) Glycogen 6. A non-protein organic molecule needed for proper enzyme functioning. g) Cellulose 7. Pyrimidine base found only in RNA. h) Galactose i) Fructose 8. Increasing the number of these molecules in the cell membrane would increase the permeability of the cell membrane. i) Thymine k) Uracil 9. Bond which connects nucleotide monomers together. 1) Fatty acid m) Disaccharide n) Peptide bond o) A-Helix p) B-Pleated Sheet q) Ribose r) Deoxyribose 10.
- You are studying the tripep de Lys-Val-Thr. a) Could you use the absorbance at 280 nm to determine the concentra on of this tripep de? Briefly explain your answer. b) Show how the charge of this pep de would change at different pHs.An octapeptide was hydrolyzed and the amino acids separated. Its amino acid composition was determined: Gly (1); Ala (2); Val (1); Lys (2); Met (1); Asp (1). After incubation with FDNB and hydrolysis, 2,4-dinitrophenylalanine was detected. NO, H N -C- COOH H O,N CH, Treatment with cyanogen bromide, which cleaves at M, resulted in two fragments: a pentapeptide containing two K residues and a tripeptide containing V, G, and A. The residues are not listed in any particular order. After treatment with trypsin, which cleaves at R and K, there were three fragments: two dipeptides and MGAV. What is the sequence of the octapeptide? Use the one-letter abbreviations for the amino acids, and do not use dashes. octapeptide sequence:Draw the following Lipids in: A) Condensed (detailed) Structure, B) its Block Diagram.C) Show/Indicate the type of linkages per structure (put an arrow). 4) Sphingolipid/Sphingophospholipid (use sphingosine, myristic acid, phosphate, and choline for amino alcohol);
- Cysteine is converted to cystine which is readily transported into mammalian cells. In the cells, cystine is converted back to cysteine, an essential amino acid needed to synthesize biomolecules such as proteins, or Coenzyme A3. What reagents would you choose to make the disulfide bond in the lab? Choose all that would produce the disulfide bond.What is the melting temperature and G/C content of the following primers? a.) 5’ GAAATAATTTTGTTTAACTTTAAG 3’ b.) 5’ GTAACTCAGCTTTCAGGTCG 3’b) Determine which ionization state corresponds to aspartic acid (shown below) at pH 1, 7, and 10 by selecting the most suitable answer from the statements i-iv. The pK of the amine, carboxylic acid, and side chain of aspartic acid are 9.6, 1.88 and 3.65, respectively. ОН ÓH ÑH2 i) the amine is charged; the carboxylic acids are neutral. ii) the amine and carboxylic acids are all charged. iii) the amine is neutral, and the carboxylic acids are charged. iv) the amine and the carboxylic acids are all neutral. pH Statement (i, ii, iii, or iv) 1 7 10 %3D