I have built an urn model for a DNA sequence. I have taken the letters from a sequence 1946 nucleotides long. The urn contains 259 Adenines, 699 Cytosines, 401 Thymines and 587 Guanines How many start codons will I find on average in the entire sequence when I draw all of the bases from the urn without replacement? Please I'm not too sure how to tackle this.
Q: Assume that you are conducting a chain-addition polymerization using 5.47 grams of monomer (MW=…
A: The number of moles is given by the ratio of the given mass in grams to the molar mass(MW) No. of…
Q: Elongation of fatty acids chains beyond 16 carbons takes place: on the membrane of the endoplasmic…
A: Acetyl CoA from glucose oxidation or other anaplerotic reactions is produced in mitochondria and…
Q: 3. Question from Lehninger...describe the common structural features and the differences for each of…
A: Carbohydrates or carbs are maconutrient consisting of Carbon, hydrogen and oxygen atoms. They are…
Q: 4. Describe the role of His in the catalytic mechanism shown.
A: Enzymes are highly specialized proteins that have extraordinary catalytic power, greater than that…
Q: Draw the fractional binding curve with protein that bind to a molecule of ligand L.
A: A ligand is a molecule that binds to a receptor. The specificity of the ligand varies. One ligand…
Q: The covalent catalytic mechanism of an enzyme depends on a single active site Cys residue with a…
A: Covalent catalysis is a type of enzymatic reaction mechanism that involves the formation of covalent…
Q: Which of the following is an anomer of B-D-gulopyranose? O ОН I ОН т ОН I I ОН CH2OH II- Б ОН CH2OH…
A: Anomers are cyclic monosaccharides differing from each other in the configuration at carbon no -1…
Q: Based on your molecular weight predictions from computational analysis of the DHFR fusion proteins…
A: Glutathione S-transferase (GST): Affinity tags are efficient methods that have been employed…
Q: Show below is a polypeptide comprised of 3 α-helices and 5 β-sheets joined by randomcoil.…
A: Tertiary structure of a protein is the 3-D structure of the polypeptide after it has undergone…
Q: Answer the Questions below: 1. Based on the experiment above, what is the means of detecting the…
A: Lipids are hydrophobic compounds that are usually made up of an alcohol backbone and a long chain…
Q: Draw the electron pushing mechanism
A: Electron pushing mechanism shows the jumping of electrons in the substrate and reaction…
Q: Secondary messengers and their role in the mechanisms of hormonal influence on target cells:…
A: Phosphatidylinositol (PtdIns) is a lipid molecule composed of an inositol ring and two fatty acid…
Q: What is the total number of moles of ATP generated per mole of glucose in the glycolytic pathway and…
A: Cellular respiration is a collection of three metabolic pathways that generate ATP by the oxidation…
Q: what are correct about enzyme kinetic parameters
A: Enzymes are high molecular-weight proteins that catalyse biochemical reactions. They contain an…
Q: Which of the following statements are true for enzymes? Check all that apply. The activity of some…
A: Enzymes catalyse biochemical reactions by decreasing the activation energy and increase the rate of…
Q: In expressing therapeutic proteins (check all that apply): Bacteria could be used if you want the…
A: Therapeutic proteins are genetically engineered proteins of mammalian origin. These proteins are…
Q: Which of these are artificial sweeteners (Arts) and which are metabolized (Mtbs) by glycolysis?…
A: Artificial sweeteners are synthetic substitutes for sugars. These are sweet in taste and have less…
Q: how GABA balances glutamate to prevent seizures and what is one GABA drug that is used to do that.…
A: Glutamate is a precursor of GABA. The enzyme glutamate decarboxylase catalyzes the decarboxylation…
Q: You want to study a biomolecule in the laboratory. You have ordered the synthetic gene from a…
A: The process by which a specific gene sequence of interest is ligated and then the newly synthesized…
Q: 18:249, 12 refers to a fatty acid that contains: 18 carbons, 2 double bonds, and saturation at…
A: Fatty acids are the simplest type of lipids. They are carboxylic acids with hydrocarbon chain. They…
Q: Regarding energy metabolism, the used an equal mix of carbohydrates and fat. a. VT3 b. VT2 C. VT1 d.…
A: Our body needs to burn fuels, to acquire the energy needed to do work. The major respiratory fuels…
Q: Substances like phencyclidine (PCP, or "angel dust") and ketamine ("Special K") are characterized…
A: INTRODUCTION : Phencyclidine : It is a synthetic drug, which is a compound being derived from…
Q: The structure given below represents what molecule?
A: Cellular respiration is the process how biochemical energy is generated from food. It involves the…
Q: I. Essay: Explain the following question with the use of illustrations. Briefly describe them with…
A: “Since you have posted a question with multiple sub-parts, we will solve the first three sub-parts…
Q: Classify each metabolic reaction as an oxidation-reduction reaction, isomerization reaction, or…
A: Metabolism is the total of all chemical transformation that takes place in a living cell. One…
Q: What are some applications for metalloproteins?
A: Metalloproteins are the types of proteins or enzymes that binds to a metal ion as a cofactor in…
Q: 2.5 2 1.5 1 0.5 0 Mike has determined that enzyme he is attempting to purify has an isoelectric…
A: The isoelectric point (pI) of a protein is a pH at which the net charge of the protein is zero. That…
Q: c) 1.0 1.2 Estimate Vmax and KM for all cases. What type inhibitor is [I]? Estimate K₁ and/or Kı'…
A: Enzymes are usually comprise of protein molecules which is used to catalyzed several biochemical…
Q: How much more does cytokine 2 gene expression change in severe COVID-19 patients than in mild…
A: Cytokine storm is the condition when various cytokines are expressed in very high levels. This cause…
Q: True or False: Spectrophotometric assays always track the rate of reaction through a. True b. False…
A: Spectrophotometry is the method that uses light beam to measure the concentration of a chemical or a…
Q: Which enzyme activity would be inhibited if fluorodeoxyuridine-5 monophosphate is present?…
A: The compound fluorodeoxyuridine 5’-monophosphate (FdUMP) is a compound that has similar structure to…
Q: Fatty acids and triglycerides are an important source of nutrition and a dense form of stored…
A: Carbohydrates are the primary source of energy. But in the absence of carbohydrates, the body…
Q: could the answer be no cooperativity as well?
A: Cooperative binding is a phenomenon where the binding of one molecule increases the affinity of the…
Q: A student performed an invertase activity assay on samples from a purification. All reactions…
A: Beer Lamberts law relates absorbance with concentration of analyte. The Beer lamberts expression is…
Q: Fill up the table below to summarize the confirmatory test for casein and whey. Test Sample…
A: Casein and whey are the 2 important classes of proteins in milk. The human milk composition is…
Q: Mechanism of action of electron transport inhibitors. Amital.
A: INTRODUCTION : First of all, there is no electron transport inhibitor called Amital, it is a wrong…
Q: True or false: The contributions to the change in Gibbs free energy of binding for a lipid ligand in…
A: Though the biological membrane is primarily composed of lipid bilayer, membrane proteins perform…
Q: In order to break the carbon-carbon bond of Acetyl-CoA in a way that does not harm the cell, citrate…
A: Glycolysis is the metabolic pathway by which 6-carbon glucose is converted into 3-carbon pyruvate in…
Q: Which of the following results are most likely to be observed in liver enzymes following initiation…
A: When subjected to a prolonged period of starvation, the level of glucose in the blood falls. This…
Q: Why is cholesterol an important steroid?
A: Steroids are the compounds that consist of three cyclohexane rings and a cyclo pentane ring in…
Q: Show the chemical equations of the following lipid tests: (1) acrolein test, (2) saponification, (3)…
A: lipids when hydrolyzed with sodium or potassium hydroxide in aqueous or alcoholic environment,…
Q: Glucose and fructose are both C6H12O6. What is the structural difference between them? Glucose is a…
A: carbohydrates are carbon molecules which undergo oxidation to yield energy. Carbohydrates are…
Q: a) Describe the three irreversible reactions of the Citric Acid Cycle. Ensure to indicate their…
A: Krebs cycle or tricarboxylic acid (TCA) cycle in aerobic organisms is the final stage of catabolism…
Q: Tumor necrosis factor (TNF) signaling Discuss the nature of the TNF ligand and the receptor for…
A: Cell signaling pathway involves a cascade of reactions inside the cell which is triggered by small…
Q: After 7 rounds of b-oxidation completely converts fluorooleate into acetyl-CoA, draw the molecule…
A: Fatty acids are carboxylic acids with a hydrocarbon chain ranging from 4 carbon to 36 carbons.…
Q: 5. We're back in the lab having fun! Our current experiment calls for us to treat our cells with THC…
A: A stock or standard solution is one whose concentration is precisely known. Stock solutions can be…
Q: Glycogenesis occurs in both muscle and liver. Select one: O True O False Glycogen is released from…
A: Glycogen is storage-type homopolysaccharide that contain two types of glucose polymers: amylose:…
Q: Calculate the volumes of the 100 mM PNPP stock solution and buffer (final volume of 1.00 ml) needed…
A: Molarity is way of representing the concentration of a solution. Molarity is the number of moles of…
Q: Which is CORRECT for the flow of electrons from NADH? NADH Complex I→ ubiquinone → Complex III →…
A: The electrons from NADH is transferred via a series of complexes to synthesize ATP. This is known as…
Q: n a table, write down the enzyme that acts on proteins and also mention the final product of…
A: Introduction: Enzymes are proteins that act as biological catalysts to fasten the rate of the…
I have built an urn model for a DNA sequence. I have taken the letters from a sequence 1946
How many start codons will I find on average in the entire sequence when I draw all of the bases from the urn without replacement?
Please I'm not too sure how to tackle this.
Step by step
Solved in 2 steps with 1 images
- Below is a sequence of 540 bases from a genome. What information would you use to find the beginnings and ends of open reading frames? How many open reading frames can you find in this sequence? Which open reading frame is likely to represent a protein- coding sequence, and why? Which are probably not functioning protein-coding sequences, and why? Note: for simplicitys sake, analyze only this one strand of the DNA double helix, reading from left to right, so you will only be analyzing three of the six reading frames shown in Figure 19.4.State the properties of the WatsonCrick model of DNA in the following categories: a. number of polynucleotide chains b. polarity (running in same direction or opposite directions) c. bases on interior or exterior of molecule d. sugar/phosphate on interior or exterior of molecule e. which bases pair with which f. right- or left-handed helixIf the sequence of amino acids encoded by a strand of DNA is serine-alanine-lysine-leucine, what is the order of bases in the sense strand of DNA? Use the codon chart below to help you: second letter A G UAU Tyr UGU UUU UCU Phe Сys UUC UCC UAC UGC Ser UAA stop |UGA stop | A UAG stop UGG Trp UUA UCA UUG Leu G UCG CUU CCU CAU CGU His CUC ССС САС CGC Leu Pro Arg CUA ССА САА CGA Gln CUG CCG CAG CGG AUU ACU AAU AGU Asn Ser AUC le A AUA AAC AAA AGC AGA Arg АСС Thr ACA AUG Met | ACG AAG Lys AGG GUU GCU GAU GGU Asp GUC Val GUA GAC S GAA Glu GCC GGC Gly GGA Ala GCA GUG J GCG GAG GGG) O 3' AGACGTTTCAAT 5' O 3' UGUGCAAAGUUA 5' О 5 TGTGCTTТCТТА 3' first letter UCAG UCAG PCAG third letter
- Second letter C A UUU Phenyl- UUC alanine UCU UCC UAU UAC UGU UGC Tyrosine Cysteine Serine UCA UCG UAA Stop codon UAG Stop codon UGA Stop codon UGG Tryptophan UUA A Leucine UUG CCU ССС CAU CAC CUU CGU CGC Histidine C CUC C CUA Leucine Proline Arginine CCA СCG CGA CGG A CAA CAG CUG Glutamine AGU AGC AUU AAU ААС ACU Asparagine Serine AUC Isoleucine A AUA ACC АСА Threonine AAA AGA Methionine; start codon ACG Lysine Arginine AUG AAG AGG U GUU GUC GUA GCU GCC GCA GAU Aspartic GAC acid GGU GGC GGA GGG Valine Alanine Glycine GAA Glutamic GAG acid GUG GCG G Given the codon UCA in the first exon of a gene, which change is most likely to result in a nonsense mutation? A transversion of A to U Change of nucleotide in the third position Change of nucleotide in the first position A transition of A to G Change of nucleotide in the second position First letter Third letterThe sequence of a polypeptide is determined by the order of codons that specify the amino acids in the polypeptide. How many different sequences of codons can specify the polypeptide sequence methionine-histidine-lysine? (Use the table to find the number of possibilities.) SECOND BASE UAU UACFTyrosine (Tyr) UAA -Stop codon UAG -Stop codon UUUL UGU Cysteine (Cys) UCU uc UCA FSerine (Ser) uca Uuc Phenylalanine (Phe) UUAL Leucine (Leu) CAU CAC CAA Glutamine (Gin) CAGF UGA -Stop codon uaa -Tryptophan (Trp) CGU сос CGA FArginine (Arg) CU CU Histidine (His) CuA FLeucine (Leu) Cua) Proline (Pro) CCA cca AAU Asparagine (Asn) AGU Serine (Ser) AGC AUU ACU ACC Threonine (Thr) AACF AAA AAGLysine (Lys) AUC Fisoleucine (lle) AUA Methionine (Met) AUG - Start codon ACA ACG AGA AGGFArginine (Arg) GU GACAspartic acid (Asp) GGA GAA Glutamic acid (Glu) Gaa) GcU -Valine (Val) G GUA GCA FAlanine (Ala) Glycine (Gly) 8. 1 4 THIRD BASE 2. FIRST BASEPart of a sequence of DNA from a person without this genetic disease is: TAG TAA AAA CCA CCC AGG Part of a sequence of DNA from a person with a genetic disease is: TAG TAA CCA CCC AGG The possible codons for some amino acids are shown in the table. Amino acid Codons glycine GGU GGC GGA GGG isoleucine AUU AUC phenylalanine UUU UUC serine UCU UCC UCA UCG Which amino acid is missing from a person with this genetic disease? serine glycine O phenylalanine isoleucine
- What amino acid sequence will be generated, based on the following DNA codon sequence? Did you read this question carefully also? Are you certain? (You may list the three letter abbreviations for the amino acids listed below) DNA Sequence: TAC AAG CCC TAG GCG ATA АТС [a] Table 1. MRNA codons & associated amino acids Second base C G UUU Phe UUC UCU UAU UGU U Тyr UAC Cys UGC UCC Ser UCA UAA Stop UGA Stop A UUA Leu UUG UCG UAG Stop UGG Trp G CUU CCU CAU] His CAC CGU CUC C CUA CGC Leu Pro CCA Arg CGA CAA Gin CUG CCG CAG CGG AUU ACU AAU Asn AAC Thr AAA Lys AAG AGU Ser AGC AUC Ile ACC AUA AGA Arg AGG ACA AUG Met or start ACG GUU GCU GAU GGU Asp GAC U GÚC GCC Ala GCA GGC Val GUA Gly GAA GGA Glu GAG GUG GCG GGG G Cooriaht O Pearson Education. Inc Dublishina as Beniamin Cumminas First base (5' end) Third base (3' end)Please by using the first base of each as the first triplet in a condo, how do I translate two almost identical RNA strand into sequences? You will notice that the second strand has a point deletion (the u in bold) with respect to the first strand – comment on how this has affected the resulting peptide chain. aguuguuaucgaaaacugcgaguaaauauccugagggcgcgaagcaacc aguuguaucgaaaacugcgaguaaauauccugagggcgcgaagcaaccBelow is a sequence of DNA.5'-ttaccgataattctctctcccctcttccatgattctgattaaagaaggcgagaacgaaactatttgttaatacc-3' How many "reading frames" can be identified for this sequence? How many "open reading frames" can be identified for this sequence? What is the frame of the longest ORF? How many codons are in the longest ORF? What is the frame of the shortest ORF? How many AA are in the shortest ORF? Using the one letter code for Amino Acids, what is the predicted AA sequence of the shortestORF (from N to C-terminal end)? Using the one letter code for Amino Acids, what is the predicted AA sequence of the longestORF (from N to C-terminal end)?
- The following questions refer to this table of codons. Second Base U A G UUU UCU UAU UGU ] Cys Phe Tyr UUC UCC UAC UGC Ser UUA UCA UAA Stop UGA Stop Leu UUG UCG UAG Stop UGG Trp CUU CCU CAU CGU His CUC CCC CAC CGC Leu Pro Arg CUA CCA СА CGA Gin CUG CG CAG CGG AUU ACU AAU AGU Asn Ser AUC Ile ACC AAC AGC Thr AUA ACA AAA AGA Met or Start ] Lys Arg AGG AUG ACG AAG G GUU GCU GAU GGU Asp GAC GUC GCC GGC G Val Ala Gly GUA GCA GAA GGA Glu GUG GCG GAG GGG What amino acid sequence will be generated, based on the following mRNA codon sequence? 5' AUG- UCU- UCG- UUA- UCC- UUG 3' met-arg-glu-arg-glu-arg met-ser-ser-leu-ser-leu met-glu-arg-arg-glu-leu met-ser-leu-ser-leu-ser First Base Third BaseIf I tell you that a stretch of DNA in the 5' to 3' direction is AGGTACGACCGT Give me the complimentary strand without and spaces, commas, symbols or anything else besides the nucleotide sequence (e.g. only: AAGCATCCGCTTA). Give me the complimentary sequence in the 3' to 5' orientation.5' GTGCTAGCGGGAATGAGCTGGGATACTAGTAGGGCT 3' 3' CACGATCGCCCTTACTCGACCCTATGATCATCCCGA 5' Template Strand: 9. Using the template strand, transcribe the DNA above, Be sure you write your sequence 5 - 5 a indicate the 5' and 3' ends of any nucleic acid molecule(s). 10. Use the codon chart below to translate your mRNA into an amino acid sequence. Begin at the first codon. Third First position (5' end) Second position position (3'end) UGU Cys UAU Tyr Cc UGC Cys UGA Stop UGG Trp UCU Ser -Y UAC Tyr UAA Stop UAG Stop UUU Phe - F UUC Phe UUA Leu UUG Leu FL UCC Ser -- UCA Ser UCG Ser CGU Arg CGC Arg ER CGA Arg CGG Arg CCU Pro CAU His CUU Leu CUC Leu -- CAC His CAA Gln CAG Gln CCC Pro -P A - CUA Leu CUG Leu CCA Pro CCG Pro AAU Asn AAC Asn AGU Ser AGC Ser AGA Arg ACU Thr AUU lle AUC lle AUA lle AUG Met M ACC Thr -T ACA Thr ACG Thr A. AAA Lys K AAG Lys -R AGG Arg A. GAU Asp -D GAC Asp GGU Gly GGC Gly GCU Ala GUU Val GUC Val GCC Ala A -G GGA Gly GGG Gly A -V GUA Val GUG Val GCA Ala GCG Ala GAA Glu -E…