Q: The enzyme that removes the RNA primer from the Okazaki fragment is: A DNA ligase B DNA gyrase (c)…
A: The double standard DNA molecule is produced by the action of DNA volume range and the process…
Q: A DNA sequence can be represented as a string of the letters ACTG (short for , cytosine, guanine,…
A: The sequence of DNA defines the order of the four chemical building blocks called bases that make up…
Q: The enzyme responsible for adding new nucleotides to a growing DNA chain during DNA replication is…
A: DNA is the nucleic acid that stores genetic information.
Q: Dr. A. Zion wants to study the flight gene of birds. In order to study the DNA, he must first…
A: Genes are the sections within the long DNA molecule. To study DNA, you first have to get it out of…
Q: A gene is made up of (choose one: RNA, protein, DNA, carbohydrate).
A: A gene is the functional unit of inheritance. These are made up of DNA. These genes contains…
Q: What is the smallest unit of heredity?a. chromosome b. genec. codond. nucleotide
A: Sir Gregor Mendel was a priest and a teacher who did the famous hybridization experiment on garden…
Q: If one nucleotide is randomly changed in a DNA sequence, that is an example of ___ mutation
A: To answer this question we should have knowledge of biochemistry.
Q: Describe and diagram the DNA damage done by UV radiation on a single strand of DNA. Describe in at…
A: The DNA molecules that encode its genome in human cells DNA damage is subdivided into two types:…
Q: The process of transcription is represented by letter
A: DNA is transcribed into mRNA and mRNA is translated into protein.
Q: The _____________ strand is made continously.
A: DNA replication in eukaryotes is semiconservative, semicontinuous, and bidirectional. It occurs in…
Q: DNA RNA PROTEIN
A: The central dogma is a molecular biology process that converts DNA to RNA and creates a functioning…
Q: - sequence is there an error in the DNA
A: The advent of technology has lead to discovery of structure of DNA by Watson and Crick in 1950. This…
Q: A DNA nucleotide triplet that codes for the amino acid alanine is a. CCA b. CGG C. CCU d. CGU
A: Introduction The molecule that carries the genetic information necessary for an organism's growth…
Q: View the given linked video to see the detailed structure of the different kinds of DNA. After…
A: DNA is the basic genetic unit of many organisms. DNA is a nucleic acid which content genetic…
Q: Mutations within a DNA sequence are
A: Mutations are errors in the DNA replication process. It may be either due to mistakes when the DNA…
Q: GENE C DNA AGCAGG MRNA Amino Acid
A: DNA and RNA are nucleic acids present in the organisms. DNA is the deoxy ribose nucleic acid whereas…
Q: Define the following terms:a. A-DNAb. B-DNAc. Z-DNAd. cruciforme. palindrome
A: "Since you have posted a question with multiple sub-parts, we will solve the first three sub-parts…
Q: GENE I DNA AGCCTACG C MRNA Amino Acid
A: The correct sequence of mRNA and amino acid name is shown below.
Q: TAG, TA, and TGA are stop codor
A: 4) The 5' cap is added to the first nucleotide in the transcript during transcription. The cap is a…
Q: ENE 2: Nose Style DNA Template Strand ATG- GGG- CTT- CTC- TTT MRNA tRNA Amino Acids APPEARANCE
A: Above table is codon anti-codon table for translation of DNA code into protein sequence.
Q: DNA figure
A: DNA is the genetic material of approximate all living organisms, the structure of the DNA is very…
Q: A segment of DNA has the sequence ATGCCT. What will be the sequence for the transcripted segment? O…
A: Transcription is the cycle by which the data in a strand of DNA is replicated into another particle…
Q: GENE A DNA ACCGGTTAT MRNA Amino Acid
A: Answer. DNA replication is a process that takes place inside the nucleus of the cell. During…
Q: the following segment of DNA codes a protien. 5' - TGATGATATTCCAgaargGATG AGCaataGCACATTGATA-3
A: Post-transcriptional modification of m RNA involves the removal of all the introns and linking up of…
Q: The DNA of identical twins is an exact match.
A: Yes DNA of identical twins is an exact match and is 100% match as they are formed from the same egg…
Q: A noncoding DNA sequence within a gene is called a(n) _____________.
A: BASIC INFORMATION DNA It stands for deoxyribo nucleic acid. It is the genetic material of all…
Q: _____________ is responsible for adding new nucleotides to the DNA strand being created.
A: Two long polynucleotide chains made up of four diverse nucleotide sub units make up a DNA particle.…
Q: Expressed sequences of DNA are called ________________.
A: DNA or deoxyribonucleic acid is a molecule composed of two polynucleotide chains that coil around…
Q: A forensic sample contains a mixture of female epithelium cells and male sperm cells. How will you…
A: DNA profiling is a highly effective method for resolving criminal cases. If sufficient DNA from just…
Q: double-stranded DNA is dissociated into
A: All organisms must replicate their DNA when cells divide. During DNA replication, an enzyme called…
Q: DNA = TAG - TAG - GAT MRNA = Amino Acids = Phenotype = %3D
A: THE ANSWER IS IN NEXT STEP :
Q: The process whereby DNA molecules are cut and rejoined in new combinations is called _____________ .
A: DNA (deoxyribonucleic acid) is the double-stranded molecule that is the genetic material in most…
Q: Using the following DNA sequence what would be the complementary DNA made during replication? TAC…
A: Complementary DNA is synthesized from a mature mRNA strand and it lacks both promoters and introns.…
Q: GENE H DNA CGCCCCTAT MRNA Amino Acid
A: DNA and RNA are nucleic acids present in the organisms. DNA is the deoxy ribose nucleic acid whereas…
Q: Define the term DNA.
A: Gregor Mendel: Father of genetics Genetic material are the substance which are responsible for the…
Q: identify the following genetic terms in order from smallest to largest. Gene - Nucleotide -…
A: Cell growth and division is mainly regulated by the nucleus of the cell. This nucleus contains…
Q: Name the second complementary base from the 5' direction. USE ALL CAPITAL LETTERS ONLY. Name the…
A: Nucleic acids are biopolymers made of nucleotides. The nucleotides are in turn made of nucleosides.…
Q: of the following DNA models is accurately labeled? a. b. A d. 3'
A: The molecule found inside cells that holds the genetic information necessary for an organism's…
Q: What is an example of a disease or a disorder that results from an error in DNA replication? What…
A: Errors in DNA replication is called as mutation. This results in the change in sequence of DNA which…
Q: Define the following terms:a. DNA typingb. short tandem repeatsc. DNA profiled. ribozymee. noncoding…
A: Introduction:
Q: GENE G DNA GTCGTCTII MRNA Amino Acid
A: The DNA is transcribed into the RNA by the process of transcription while the RNA is translated into…
Q: Identify if the statement is correct or incorrect, "DNA synthesis begins at specific nucleotide…
A: DNA replication is the process by which DNA generates a copy of itself during cell division using a…
Q: The name of the enzyme that cuts the DNA in order to remove a section of broken DNA is called A)…
A: The damaged DNA strand is cut at two points by an enzyme called nuclease, and the damaged segment is…
Q: ent of DNA is usec ranscription. This
A: During DNA transcription DNA strand is transcribed into mRNA with the help of RNA polymerase. DNA…
Q: K G J B L H.
A:
Q: GENE F GGACGCGGG DNA MRNA Amino Acid Trait
A: GENE F DNA (Double helix- gene) (Replication) GGA CGC GGG mRNA (Transcription) GGA CGC GGG…
Q: GENE B DNA ACCCAACA A MRNA Amino Acid
A: A codon is a trinucleotide sequence of DNA or RNA that corresponds to a specific amino acid.
Q: Exons are part of the DNA that are transcribed True False
A: The DNA acts as the genetic material in most of the species including us, the humans. The process of…
Q: No. of nucleotide found in DNA segment if it contains 100 Adenine and 100 cytosines, (a) 100 (b) 200…
A:
Q: GENE F DNA GGACGCGGG MRNA Amino Acid
A: DNA and RNA are nucleic acids present in the organisms. DNA is the deoxy ribose nucleic acid whereas…
Step by step
Solved in 2 steps
- If DNA segments changes from GCATAG to GCATGG, this is a: MRNA Codon/Amino Acid Chart First Base Second Base Third Base A G UUU1 Phenylalanine UCUT UAUT FTyrosine (Tyr) UAC UGU, U FCysteine (Cys) UGCJ UUCJ (Phe) UCC Serine (Ser) UCA U UGA - Stop A UUA1 FLeucine (Leu) UUG- UAA1 FStop UAGJ UCG- UGG - Tryptophan (Trp) G CUU CAU1 CCU1 CGUT Histidine (His) CAC- CUC CCC Proline (Pro) CCA CGC FLeucine (Leu) CUA FArginine (Arg) CGA CAA1 Glutamine A CAGJ (Glu) CGG- CUG- CCG- ACU AAUJ Asparagine AUUT AGUT FSerine (Ser) AGC- U AUC FIsoleucine (lle) ACC AACJ(Asn) Threonine A AUA- (Thr) AAA1 FLysine (Lys) AAG- АСА AGA, FArginine (Arg) AGG- A Start Methionine AUG- (Met) ACG- G GUU GCU, GAU1 Aspartic Acid GGU U GAÇJ(Asp) GUC Fvaline (Val) GUA GCC GGC G Alanine (Ala) GCA Glycine (Gly) A GAAJ Glutamic Acid GGA GAG- (Glu) GUG- GCG- GGG- GUsing the codon charts in your text (section 6.1), fill in the chart below. [ /8] Original DNA sequence TAC GGA CAC GTT CGC AAC mRNA sequence tRNA anticodons Amino acid sequence Mutated DNA sequence TAC GGA CAC ATT CGC AAC mRNA sequence tRNA anticodons Amino acid sequence Type of mutation (highlight all that apply) Frameshift Nonsense Missense Silent Insertion Deletion SubstitutionIf the sequence of amino acids encoded by a strand of DNA is serine-alanine-lysine-leucine, what is the order of bases in the sense strand of DNA? Use the codon chart below to help you: second letter A G UAU Tyr UGU UUU UCU Phe Сys UUC UCC UAC UGC Ser UAA stop |UGA stop | A UAG stop UGG Trp UUA UCA UUG Leu G UCG CUU CCU CAU CGU His CUC ССС САС CGC Leu Pro Arg CUA ССА САА CGA Gln CUG CCG CAG CGG AUU ACU AAU AGU Asn Ser AUC le A AUA AAC AAA AGC AGA Arg АСС Thr ACA AUG Met | ACG AAG Lys AGG GUU GCU GAU GGU Asp GUC Val GUA GAC S GAA Glu GCC GGC Gly GGA Ala GCA GUG J GCG GAG GGG) O 3' AGACGTTTCAAT 5' O 3' UGUGCAAAGUUA 5' О 5 TGTGCTTТCТТА 3' first letter UCAG UCAG PCAG third letter
- (ol soupe bannos96 SAM 3 A small strand of DNA has this sequence: 0pxbeter owl nade hoparg TACCGGAAACTG ATGGCCTTTGAC a. If the TOP strand is the template strand, what will be the mRNA made from this DNA read from left to right? What process allows for the mRNA to be made? b. If this is a eukaryotic mRNA, where does transcription occur? What would happen if the mRNA was not processed? c. What is the sequence of the protein made (use the genetic code below)? What process allows for the protein to be made?Use the codon chart to determine the following RNA strand in amino acids (Remember to write it the same way the strand is): ACA-AGG-UUA-UGA second letter C A UAU Tyr U UUU UCU UGU Phe Cys UUC UCC UAC UGC C Ser UAA stop | UGA stop| A UAG stop UGG Trp UUA UCA UUG Le UCG CUU CCU CAU CGU His CUC ССС CAC CGC Leu Pro Arg CUA ССА САА CGA Gln СCG CAG CGG CUG AGU AAU Asn AUU ACU Ser AGC S AGA Arg AAC AUC } lle A AUA АСC Thr AAA Lys АСА AUG Met ACG AAG AGG GUU GCU GAU GGU Asp GAC GGC Gly GGA GCC GUC Val Ala GAA GAG } GUA GCA Glu GGG GUG GCG Your answer first letter ACUCAGUCAGUCAG third lettermRNA Codon Chart: Second letter с บบบ UCU UAU Phe UUC UCC U Ser UAC Tyr UGU UGC Cys UUA UCA Leu UAA Stop UGA Stop A UUG UCG UAG Stop UGG Trp CUU CCU CAU CGU CUC CCC His CAC Leu Pro CUA CCA CAA CGA Arg Gin CUG CCG CAG CGG AUU ACU AAU AUC lle ACC AAC AGU ]Asn Ser AGC A Thr AUA ACA AAA Lys AGA Arg AUG Met ACG AGG GUU GCU GAU GUC GCC Val GAC Asp GGU GGC Ala GUA GCA GUG GCG GAG GGG GAA Glu GGA Gly Amino Acid 3-Letter Codes Name of Amino Name of Amino 3-Letter Code 3-Letter Code Acid Acid Alanine Ala Leucine Leu Arginine Arg Lysine Lys Asparagine sex Methionine Met (start) Aspartic Acid Asp Phenylalanine ebe Cysteine Cve Proline Pro Glutamic Acid Glu Serine Ser Glutamine Gln Threonine Glycine GLK Tryptophan JAR Histidine His Tyrosine Tyr Isoleucine lle Valine Val Exercise: Transcription & Translation 1. Choose 3 DNA Templates. 2. Write the mRNA sequence divided into 3 letter codons. 3. Write the sequence of amino acids. 4. Find the corresponding amino acid sequence and include the letter of…
- FIRST BASE UUU- UUC UUA UUG U CUU- CUC -Phe -Leu DNA Sequence tRNA Sequence (anticodon) -Leu CUA CUG AUU- ACU AUC lle ACC AUA ACA Met or AUG Start ACG- GUU GUC GUA GUG mRNA Sequence (codon) AMINO ACID Sequence SECOND BASE C -Val UCU- UCC UCA UCG- CCU CCC CCA CCG GCU GCC GCA GCG Ser -Pro Thr Ala AAG GAU UAU Cys UAC UAA Stop UGA Stop UAG Stop UGG Trp CAU- CGU -His CAC CGC CAA CGA -Gin CAG CGG AAU- AGU- AAC- AGC AAA- AGA AGG GGU- ASP GGC GGA GGG GAC- GAA GAG UGU- Tyr UGC- Asn Lys G Glu Arg 2 1. In your bag is a specific DNA sequence. 2. Copy that sequence in the box below labeled DNA sequence 3. Transcribe the sequence in the appropriate box. 30 Ser 4. Determine the appropriate anticodon sequence. 5. Translate the appropriate sequence into an amino acid sequence using the codon chart above 6. Using the contents of the bag, create your protein. Arg Gly THIRD BASEFor the messenger RNA sequence below, find the beginning of the amino acid coding sequence and translate the sequence using the genetic code provided below. 5' - AAUUAUGGGCAAUAUGCCGGGCcGGUUAAGCG - 3' Second Letter A UGU cys u UGC Phe UCU UU U UUC UUA UAU Tyr Ser UAC UAA UAG Leu UCA Stop UGA Stop UUG UCG Stop UGG Trp CUU CU CAU His CGU c cuc Leu ccc ССА CCG Pro CÁC CAA CAG CGC CGA CGG Arg CUA CUG Gin 1st 3rd letter Ser u letter AUU ACU AAU AAC AAA AAG Asn A AUC AUA AUG lle ACC ACA AGU AGC AGA AGG Thr Lys Arg Met ACG GUU G GUC GUA GUG GCU GAU GAC GAA Asp GGU Val GCC Ala GGC Gly GCA GGA Glu GCG GAG GGG GGive the mRNA and amino acid sequence from this DNA strand: TACATACCTCGGCTTTGGCTGAAAGGTACTTATAATGCT
- Complete the complementary strand: mRNA transcription ATTCGAGGCTAAThe codon chart below shows that adenine-uracil-guanine (AUG) codes for the amino acid methionine, and cytosine- adenine-guanine (CAG) codes for glutamine in humans. RNA Codon Chart UCAGUGA Alanine Tyrosine Stop Cystoine Stop Valine G U A GTryptophan Arginine A Leucine Serine Lysine Proline Asparagine ACU lGACU Select the two amino acids that those two codons code for in carrots. O glutamine O isoleucine methionine serine O valine oupne Glycine Phenyl- acid Asparti oartic acid Histidine Glutamine Arginine uauonejos Methionine ThreonineThe DNA sequence below is transcribed from left to right (the partner/coding strand is shown). Using this sequence, write the sequence of the polypeptide that results from this gene. Be sure to appropriately label the ends of the molecule. 5'-ATGCACGGCGACTAG-3' Second letter A UAU Tyr UAC First letter U A G U UUU1 UUC UUA LOU Leu CUU CUC CUA CUG Phe GUU GUC GUA GUG Leu AUU AUC lle AUA AUG Met Val C UCU UCC UCA UCG CCU CCC CCA CCG ACU ACC ACA ACG GCU GCC GCA GCG Ser Pro Thr Ala CAU His CAC CAA CAG Gin AAU Asn AAC AAA 1 Lys AAG LYS G {}a UAA Stop UGA Stop A UAG Stop UGG Trp GAU 1 GAC Asp GAA GIU Glu GAGJ UGU UGC CGU CGC CGA CGG AGU AGC AGA AGG Cys GGU GGC GGA GGG Arg Ser Arg DOA DOA DOA DUTO Third letter Gly