Answered: If one of the strands of DNA has the…

Name: If one of the strands of DNA has the following sequence of bases runni
Uploaded: 2022-09-26T13:05:49.000Z
Channel: Bartleby
Description: If one of the strands of DNA has the following sequence of bases running in the 5-S3' direction,5'-G-G-A-C-A-A-T-C-T-G-C-3'what base is closest to the 5'-end in the complementary strand?

Science

Biology

If one of the strands of DNA has the following sequence of bases running in the 5-S3' direction,5'-G-G-A-C-A-A-T-C-T-G-C-3' what base is closest to the 5'-end in the complementary strand?

BIOLOGY:CONCEPTS+APPL.(LOOSELEAF)

10th Edition

ISBN:9781305967359

Author:STARR

Publisher:STARR

Chapter8: Dna Structure And Function

Section: Chapter Questions

Problem 2SA: What are the base-pairing rules for DNA? a. A-G, T-C c. A-T, G-C b. A-C, T-G d. A-A, G-G, C-C, T-T

See similar textbooks

Similar questions

What sequence of bases on one strand of DNA (reading in the 3′ to 5′ direction) is complementary to the sequence 5′ T-A-T-G-C-A-G 3′ on the other strand?
If the DNA sequence A-T-T-G-G-C-C-T-A on an informational strand mutated and became A-C-T-G-G-C-C-T-A, what effect would the mutation have on the sequence of the protein produced?
The DNA STRAND IS 3’ TAC-AGC-ACT-CAG-TCA 5’, and Non-template strand = 5' - ATGTCGTGAGTCAGT - 3' . If on the non-coding strand of DNA there is suddenly one T base that sneaks into the 4th sequence (from the left), or causes a mutation, then how will the RNA be formed and the chain arrangement of the amino acids produced by this mutation?
List the DNA bases that will complementary base pair with the following sequence: A-G-C-T-A-C-G
What is the sequence of bases in the strand of DNA that is complementary to the one shown below?5'-T-T-C-A-C-T-G-A-C-3' Select one: A. 3'-T-T-C-A-C-T-G-A-C-5' B. 5'-A-A-G-T-G-A-C-T-G-3' C. 5'-G-T-C-A-G-T-G-A-A-3' D. 3'-U-U-C-A-C-U-G-A-C-5' E. 5'-T-T-C-A-C-T-G-A-C-3'
The DNA STRAND IS 3’ TAC-AGC-ACT-CAG-TCA 5’ and Non-template strand = 5' - ATG-TCG-TGA-GTC-AGT - 3' . If on the non-coding strand of DNA there is suddenly one T base that sneaks into the 4th sequence (from the left), or causes a mutation, then how will the RNA be formed and the chain arrangement of the amino acids produced by this mutation? 4th sequence (from the left) should be = TCG right?
The DNA sequence you use will be the following: T - A - G - C - C - A. You will need to make the complementary strand - fill in the table below with the complementary base pairs (remember Chargaff’s rule: A = T and C = G) 5’ T A G C C A 3’ 3’ 5’
For the following DNA sequence: 3’–CGATACGGCTATGCCGGCATT–5’ Write: a) the sequence of the complementary DNA strand
If one strand of DNA has the sequence 5'-C-T-A-G-C-G-T-T-A-3', what sequence would appear opposite it on the other strand? Enter the complementary sequence of letters separated by hyphens. • View Available Hint(s) 3'- 3'-G-A-T-C-G-C-A-A-T-5' -5'
Permutation is the ordered arrangement of m number items out of a list of n items. For instance, the DNA strand with sequence of 3 bases: G-A-C IS different w ith A-G-C, C-A-G, G-C-A, A-C-G, and C-G-A. From this, we have: P-3) 3! 3x2x1 Therefore, there are 6 dıfferent sequences of DNA strands that can be formed out of 3 given bases. In general, we have this formula for permutation: (n-m)! Count the number of ways in which: Guanıne, Adenine, Cytosine, Thymıne, Cytosine, and Guanıne (6 bases) be sequenced in one DNA strand?
What is the sequence of amino acids coded by the following sequence of nucleotides on a strand of DNA from the 5' to 3' end? A - T - C - G - C - T - A - C - G - A - A - T How many nucleotides are there?
A strand of DNA contains the base pair 5’-T-C-A-G-C-A-T-3’. Give the base sequence onthe complementary DNA strand.