Answered: in the endoplasmic reticulum and…

Name: in the endoplasmic reticulum and Golgi-complex, the determination of p
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: in the endoplasmic reticulum and Golgi-complex, the determination of proper folding depends on what type of post- translational modifications? help me to understand what the answer is as i am doing correction so i can get points back.

Science

Biology

in the endoplasmic reticulum and Golgi-complex, the determination of proper folding depends on what type of post- translational modifications?

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter9: Gene Expression And Gene Regulation

Section: Chapter Questions

Problem 18QP: The following is a portion of a protein: met-trp-tyr-arg-gly-pro-thr-Various mutant forms of this...

See similar textbooks

Similar questions

Listed below are five amino acids. Use the genetic code to determine the exact codon for each amino acid. A point mutation at the genetic level in each codon results in the change indicated. For each mutation, indicate whether it is due to a transition or a transversion, and then indicate the effect of each mutation at the protein (amino acid level) (i.e. silent, nonsense, missense). In addition, Please note, each of the three lines above an amino acid represents a single RNA base. For example, when you look at the codon chart AUG would stand for Met (methionine) Lys 1 Glu Ile 3 Stop Ile 4.
Listed below are five amino acids. Use the genetic code to determine the exact codon for each amino acid. A point mutation at the genetic level in each codon results in the change indicated. For each mutation, indicate whether it is due to a transition or a transversion, and then indicate the effect of each mutation at the protein (amino acid level) (i.e. silent, nonsense, missense). In addition, Please note, each of the three lines above an amino acid represents a single RNA base. For example, when you look at the codon chart AUG would stand for Met (methionine) Lys 2 1 Glu Ile 4 Stop Ile Mutation 1: 1. Circle the appropriate answer: This mutation is a transition/transversion 2. Circle the appropriate answer: This mutation results in a missense/silent/nonsense mutation in the protein sequence. Mutation 2: 1. Circle the appropriate answer: This mutation is a transition/transversion 2. Circle the appropriate answer: This mutation results in a missense/silent/nonsense mutation in the…
Consider this list (below) of steps involved in translation. These steps are out of order. TRANSLATION: 1. the small and large ribosomal sub-units unite2. two amino acids join together.3. another tRNA anti-codon bonds with another mRNA codon 4. an initial tRNA bearing a specific amino acid arrives at the ribosome 5. the process continues until a protein molecule is completed6. at the synthesis site, initial mRNA codons are inserted
Discuss the key factors & mechanisms during co-translational translocation by which START TRANSFER and STOP TRANSFER sequences help the protein generate appropriate number of transmembrane regions with N or C terminal on the designated side of the plasma membrane.(NO PLAGIARISM)
You are observing the translation process in a eukaryotic cell that has been exposed to an unknown toxin. About halfway through synthesizing the protein, you note that elongation is stalled. Upon closer observation you notice the polypeptide is attached to the tRNA in the A-site, while the P site is occupied by an uncharged tRNA. A possible mechanism that is inhibiting translation is: Question 21 options: eEF-1βγ (beta-gamma) was inhibited from activating eEF-2. Peptidyltransferase activity was inhibited. eEF-2 was inhibited from being activated. eEF-1βγ (beta-gamma) was inhibited from activating eEF-1α (alpha). eEF-1α cannot be released from the aminoacyl-tRNA in the A-site.
Explain how plasma membrane proteins that start to be translated in the cytosol are then targeted to the ER during translation. I am looking for two things that are required here.
Indicate whether each of the following events occurs when tryptophan is high or when tryptophan is low by placing a check in each of the appropriate blanks. Share your reasoning. Event Tryptophan high Tryptophan low Ribosome does not stall at Trp codons ____________ ____________ Region 2 of the leader pairs with region 3 ____________ ____________ Ribosome covers part of region 2 of leader ____________ ____________ Transcription is terminated before structural genes are transcribed ____________ ____________
This question refers to the mRNA sequence below: 5'-AGCUG AUGGGCUGGUGCCGAGAAAGUUAGGUA A-3' What is the name of the third amino acid in the protein formed from this mRNA? Fill in the blank with the correct amino acid name, but nothing else so that Moodle can grade this question correctly.
Post-translational modification of proteins refers to the covalent and enzymatic modification of proteins following protein biosynthesis. Give three (3) examples and briefly describe why the modification is important.
Before the next elongation cycle can take place at a ribosome, the peptide chain of the peptidyl-tRNA has to be transferred to the ___ site and the deacylated tRNA has to move to the ___site. Question 46 options: A, P P, A A, E P, E there is no peptidyl transfer happening during protein translation
a- Name the figure which shows the Co-translational translocation. A or B b -list the molecules which are required for Co-translational translocation. c- Suppose you want to impair the co-translational translocation of Star protein to ER. Which strategy you choose to prevent the translocation of the Star protein to ER and maintain it in the cytoplasm. Limit your answer to two sentences. asap please.
EF-G is a macromolecular mimic of EF-tu. It's role in translation is to To cause the large subunit of the ribosome to disassociate with the small subunit of the ribosome Bind to the vacant A-site subsequent to peptide bond formation and resolve the hybrid state of the ribosome To recruit the signal recognition particle (SRP) to the ribosome and to facilitate synthesis of membrane proteins O To cause the large subunit to associate with the small subunit of the ribosome Shuttle an amino-acylated tRNA to the A site to initiate the peptidyl transfer reaction