In the following diagram, A and B are two Okazaki fragments generated during DNA replication. Solid boxes represent the primers and dotted lines represent the newly synthesized DNA strands. A B Template DNA a. To which direction (towards the left or towards the right) is the replication fork is moving?
Q: KOH required to neutralize fatty acid present in 1 g
A: Some alkali bases, such as potassium hydroxide KOH, combine with fatty acids, lipids, or oil…
Q: INCREASE in BP DECREASE in BP Increased preload Activation of the adrenergic system Venoconstriction…
A: The blood pressure alteration is influenced by many factors. The changes in blood pressure are…
Q: These are enzymes that can sustain in a high hydrostatic pressure. * (Please choose one correct…
A: Bacteria are classified into different classes based on the influence of different environmental…
Q: Under what conditions will lactic acid accumulate in skeletal muscle? Select one: A. When NADH is…
A: A reduction in muscle force generated over time or as a result of pathological conditions is…
Q: An RNA produced from a fragment of DNA has the sequence of 5'AAUUGGCU3'. The sequence of the…
A: Genetic information in our body is stored as DNA. DNA multiples itself by replication. DNA is used…
Q: The portion (the C-terminal end) of original substrate with the new amino terminus diffuses away.…
A: Introduction: Enzymes have a spectacular ability to accelerate the rate of a chemical reaction.…
Q: Match the following descriptions to the given choices Synthesized from a steroid molecule A. Vitamin…
A: Vitamin is an organic substance and an essential micronutrient that an organism needs in small…
Q: Match the following descriptions to the given choices…
A: Vitamin - The organic molecule and an essential micronutrient which is required by any organism in…
Q: Glucose are stored in the form of glycogen and any excess will be stored in the form of…
A: Glycogen is multibranched polymers of glucose and it is storage form of carbohydrates in mammals.…
Q: 1. Which of the following molecule can act as molecular chaperons for assisting the folding of…
A: A broad set of unrelated protein families whose function is to stabilise unfolded proteins, unfold…
Q: Lecithins and cephalins are both
A: Lecithin are mixture of glycerophospholipids like phosphatidylcholine, phosphatidylethanolamine,…
Q: Test Results + or -? Points awarded Code Glu – acidic end products yellow ______ _____+ Glu – gas…
A: Introduction: Microbial metabolic processes are complex but still, it permits the microbiologist to…
Q: Calculate the number of ATPATP generated from one saturated 1212‑carbon fatty acid. Assume that each…
A: Fatty acids are broken down through beta-oxidation in mitochondria. The end product of…
Q: Use the image below to determine what stage of the dog's life cycle is spent in the haploid state?…
A: Haploid stage is the condition at which cell contains only one set of chromosomes in its nucleus…
Q: Match lipid descriptions in column A with the phospholipid types in column B.…
A: Phospholipids are the important class of lipids with 2 Fatty acids attached to glycerol backbone and…
Q: If DNA were placed in an organic solvent instead of an aqueous solution, why might the Pauling and…
A: Interactions between 2 chemical (and biochemical) species can be favorable or unfavorable. Favorable…
Q: Which of the following methods can be used to compare the amounts of one specific mRNA that is…
A: A. Immunohistochemistry Deals with the measurement/determination of the distribution of an antigen…
Q: Match lipid structures in column A with its lipid type in column B
A: Lipids are the group of organic components having oily or greasy consistency. Lipids are a group of…
Q: CH3 CH3 CH3(CH2)n: O sterol O Cholesterol O Lysophosphatidylcholine O Cholesteryl ester
A: Sterols are important sub groups of steroids that contain OH at 3rd position of A ring of structure.…
Q: he figure shows that the average distance between base pairs measured parallel to the axis of a DNA…
A: The nucleic acid polymer has nucleotide as its monomeric unit. synthesis of nucleotides is an…
Q: Glucose are stored in the form of glycogen and any excess will be stored in the form of…
A: During triacylglycerol synthesis, fatty acids are linked to three alcohol groups in glycerol via an…
Q: +3 -1.5 +1 +2 -1 +1.5
A: Amino acids are organic molecules having an amino group and an acid group. Amino acids are…
Q: 2. (: A diagram of the residues defining the binding site of 2,3-bis-phosphoglycerate (BPG) is shown…
A: 2,3 bis phosphoglycerate (BPG) is an allosteric regulator of Hb. BPG binds to central cavity of…
Q: 1) Below you are given the structures of the disaccharides lactose and trehalose. но OH OH OH но но…
A: Lets first assume that all the carbohydrates given here are D isomers , cause that the general case…
Q: 4. Complete the table below: RNA DNA Strand Sugar residue Nitrogenous bases Main Function
A: Nucleic acids are made up of nucleotides, which are the fundamental building blocks of DNA and RNA.…
Q: Arrange the following FAs in decreasing melting point. * A. A 22-carbon series saturated FA B. An…
A: Melting point of Fatty acids depend upon several factors like Molecular weight Degree of Saturation…
Q: a. Name the phosphoinositide generated through the action of PI-5 kinase. b. Name the products…
A: Phosphatidylinositol (PI)-related signalling is important for survival, cell proliferation,…
Q: (1) Describe the nitrogenous base pairing in DNA and RNA. (2) Determine the number of bonds in each…
A: DNA and RNA are polynucleotides. Monomers of nucleic acids are nucleotides. Nucleotides are made up…
Q: 4. The enzyme abundantly distributed in adipocytes and germinating seeds are A. proteases B. lipase…
A: "Since you have asked multiple questions, we will solve the first question for you. If you want any…
Q: State what is the likely magnitude of the Hill constant (nH) for HbA from your reading and state…
A: Hill equation is reflects the occupancy of biomolecule by respective ligands. i.e. fraction of…
Q: Match lipid descriptions in column A with the phospholipid types in column B. H is attached to the…
A: Phospholipids have a glycerol backbone and are the major constituents of the cell membrane.
Q: Increased levels of NADH in the liver promote the process of gluconeogenesis. What do you make of…
A: Introduction: The process of synthesis of glucose or glycogen from non-carbohydrate sources in the…
Q: Explain under what conditions "substrate concentration" is the limiting factor for enzymatic…
A: Enzyme and substrate bind each other form E-S complex which decomposes to give product. Substrate…
Q: Given Raffinose, Briefly explain its expected reaction (based on their structural formula) to the…
A: Raffinose is a trisaccharide of glucose, galactose and fructose in which glucose acts as a bridge…
Q: Question 25 Он HN R Sphingomyelin Phosphocholine ceramide Sphingolipid All are correct
A: Sphingolipids are class lipids with sphingosine as core molecule Sphingomyelins are composed of…
Q: Tyrosine came from the Greek word "tyros" which means cheese as it was discovered in cheese by…
A: the isoelectric point of an amino acid is the pH at which the net electric charge of that amino acid…
Q: 5' 3' For numbers 6 to 10, refer to the image above and answer the questions. 9. How are Okazaki…
A: Okazaki fragments : These are pieces of DNA which are the transient components of the lagging strand…
Q: 2. An MRNA has a sequence AAAUUACUCGAAAUUGCGUGUAGUS'. DNA, t-RNA and amino acid sequence of the…
A: Given mRNA from 5' to 3' direction: UGAUGUGCGUUAAAGCUCAUUAAA
Q: Question 3 N-glycosyltransferase attaches which sugar to the base oligosaccharide to synthesize the…
A: A antigen is the antigen that is important for blood grouping of individuals. Antigen A and Antibody…
Q: 12. Polenske value of fatty acid indicates A. how much unsaturation is there in the fatty acid B.…
A: Volatile fatty acid : Linear small(short chain) aliphatic mono-carboxylate compound, like the acetic…
Q: What are the main structural features of an amino acid?
A: Amino acids are compounds containing carbon, hydrogen, oxygen and nitrogen. They serves as building…
Q: 8. Which of the following amino acids in hemoglobin accepts proton H+ when red blood cells reach…
A: Hemoglobin is a conjugated protein with four polypeptide chains. It contains two identical alpha and…
Q: 4. Liver alcohol dehydrogenase (LADH) catalyzes a reversible, pH-dependent oxidation of an alcohol…
A: Density=massvolumeDensity of methanol=mass of methanolvolume of methanol0.79 g/ml=mass of…
Q: A solution containing 3.58 x 1023 molecules/m3 of protein in water is separated from pure water by a…
A: Introduction: According to Fick's first law, the movement of particles from high to low…
Q: Which of the following refers to the test performed 2 hours after an overnight-fasted patient was…
A: There are two ways to take a blood sugar test. Diabetes patients use a glucometer to test their…
Q: Polysaccharides may gel through a variety of different mechanisms. Which of these statements is…
A: Carbohydrates are divided into 3 classes monosaccharides, disaccharides, and polysaccharides.…
Q: List the different molecules, an electrons is part of, as it moves from NADPH through the…
A: This is the second phase of photosynthesis , after the light dependent phase. It undertakes CO2…
Q: Nascent form of the mRNA A. undergoes splicing only after capping B. is also called hnRNA C. is…
A: A. undergoes splicing only after capping B. is also called hnRNA D. participates in the spliceosome…
Q: Assume the energy of hydrogen bonds per base pair to be 5.86 kJ-mol-1. Given two complementary…
A: Given Energy of H-Bond per base pair = 5.86 kJ mol-1 Number of Base pair in complementary DNA = 145…
Q: You want 235mL of a solution that consists of 10% BSA, 2.37mM KCl and 120µM EDTA. You have stock…
A: BSA is a globular proteins which is a well studied proteins and used as standard protein molecule in…
Trending now
This is a popular solution!
Step by step
Solved in 2 steps
- (d) Write down the sequences of the templates that would give the tetranucleotides shown in I and II. In each case, label the 5' and 3' ends and indicate which template base is used first. (e) What difference would it make to bidirectional DNA replication if both modes of chain extension were equally favourable? I II3. Consider the following diagrams representing three different DNA molecules. (a) 5' 3 3' 5' (b) 5' 3' 5' (c) 3' 5' Assuming that DNA polymerase is the only enzyme present and that there is no additional DNA, state whether each of these (= molecules can serve as a substrate for DNA synthesis. Give reasons as to why or why not.Take each of the DNA sequences and complete ALL of the following steps: i. Find the DNA Replication Complement of each strand ii. Transcribe the complement strand of DNA into an mRNA strand Translate the mRNA strand into an Amino Acid strand iii. a. ATGGACGTATAGATGACAGGTAGATGTTTCAGGGGGATTTATCGATAG b. ATGGCCATTGAGTGTCAAAAGTCTCAATGA First base U UUU UUC UUA UUG CUU CUC C CUA CUG G U -phenylalanine (Phe) -leucine (Leu) GUU GUC GUA GUG leucine (Leu) AUU AUC isoleucine (lle) Copyright © The McGraw-Hill Companies, Inc. Permission required for reproduction or display. Second base ACU ACC AUA ACA AUG methionine (Met) (start) ACG -valine (Val) UCU UCC UCA UCG CCU CCC CCA CCG GCU GCC GCA GCG C -serine (Ser) -proline (Pro) -threonine (Thr) -alanine (Ala) UAU UAC UAA stop UAG stop CAU CAC CAA CAG AAU AAC AAA AAG A -tyrosine (Tyr) GAU GAC GAA GAG - histidine (His) -glutamine (Gln) - asparagine (Asn) -lysine (Lys) -aspartic acid (Asp) -glutamic acid (Glu) CGU CGC CGA CGG AGU AGC AGA AGG G -cysteine…
- 1. Describe the process of autophosphorlyation 2. Differentiate between chromosomes and genes. 3. Think about what happens at the replication fork. If the gene for helicase is mutated, what part of replication will be affected and how? 4. There are three common types of chemical changes that can damage DNA at any time post-replicatively. In basic terms, name and describe any two of the three types of damage. please help me quickMatch the enzymes provided from (1-4) in the list of choices with their matching function (A-D) during DNA replication. A. Disrupts hydrogen bonds between DNA bases B. Can only add nucleotides to an existing 3 OH end C. Can't add nucleotides to a chain, but can make covalent bonds D. Actually a specialized form of RNA polymerase select 1. DNA polymerase select 2. Primase select 3. Ligase select v 4. Helicase3b) Briefly explain what telomerase does, how it accomplishes what it does, and why that allows a cell to completely and accurately replicate the ends of linear DNA molecules. (please note that the question does not ask you to explain the entire process of replication of the end of a linear DNA strand, it only asks about the function of telomerase in this process)
- 40.Would it be possible to start synthesizing the daughter DNA strand without assembling the RNA primer first? Why? Why not? A.Yes, because the 5' PO4 is already present in the DNA strand which will be used as a template. B.No, because the RNA primer which contains the free 3' OH in its ribose has to be synthesized by primase first. C.No, because the RNA primer which contains the free 5' PO4 in its ribose will not be synthesized by primase. D.Yes, because the 3' OH is already present in the DNA strand which will be used as a template.Which statement below is true? Select one: a. Okazaki fragments are produced in eukaryotic DNA replication but not in prokaryotic DNA replication. b. In both eukaryotes and prokaryotes, the template strand of DNA is read in the template’s 3’ to 5’ direction, while the new strand DNA is synthesized in new strand’s 5’ to 3’ direction. c. In eukaryotes, synthesis of the new DNA strand is from 5’ to 3’, whereas in prokaryotes it is random. d. In eukaryotes, synthesis of the new DNA strand is from 5’ to 3’, whereas in prokaryotes it is from 3’ to 5’. e. In eukaryotes, synthesis of the new DNA strand is from 3’ to 5’, whereas in prokaryotes it is from 5’ to 3’.1. The image shown in Figure 1 below represents a strand of DNA following replication. The black lines present above the top and below bottom strands of DNA represent the phosphodiester backbone of the molecule. Examine the DNA strands and locate any sites that are damaged, mismatched, or otherwise require repair. Indicate where in the strand the specific lesion is located, and provide a detailed overview of the post-replicative repair process that would likely be used to rectify the lesion. Assume that each lesion, even those that are located in close proximity will be repaired separately. CH, CH, OCH, CH, OCH₂CH, GATCCGAATCGGCTAGGATCGGCATCCGATTCGATCGGCATCCGATCGCTAGCO CH, CH, CH, CH, CH, TACGATCGATC CTAGGATTA CCGACCCTAGCCGTAGGGTAACGTAGCCGTAGGCTAGCGACCGGGGATGCTAGCTAG Figure 1: Graphical Representation of a strand of dsDNA containing errors and damage following replication
- Which of the following statements about RNA is/are incorrect? I. RNA strand synthesis does not occur during replication. II. All RNA strands produced during transcription are translated into proteins. III. RNA strands are composed of 10 nucleotide bases per turn. IV. RNA strands can pair with a DNA strand. V. RNA may be synthesized in the 5'-3' orientation and vice-versa (3'-5') depending on the orientation of the template DNA strand O I, II, and IV O I, II, III, IV, and V O II, IV and V O II, IV and V OI, II, III and V O Il and IIIWhich of the following statements is TRUE concerning the synthesis of the leading and lagging strands of DNA in prokaryotic cells? a. O b. The leading strand is synthesized by one polymerase III continuously, and the lagging strand is synthesized by several molecules of DNA polymerase III. d. The leading and lagging strands are synthesized at the same time by the one DNA polymerase I. O c. The leading and lagging strands are synthesized at the same time by the one DNA polymerase III. The leading strand is synthesized by one polymerase III, and the lagging strand is synthesized by DNA polymerase I.3) Why are single strand binding proteins (ssb proteins) needed in DNA replication? (note that you need to explain WHY ssb proteins are important, not just what they do)